Alternatieve splicing regelt de interactie van teneurine-latrofiline en synaps-specificiteit door een vormveranderend mechanism

Alternatieve splicing regelt de interactie van teneurine-latrofiline en synaps-specificiteit door een vormveranderend mechanism

mei 11, 2020 0 Door admin

Translating…


CBD Olie kan helpen bij ADHD. Lees hoe op MHBioShop.com


Huile de CBD peut aider avec TDAH. Visite HuileCBD.be


 

Abstract

The trans-synaptic interaction of the cell-adhesion molecules teneurins (TENs) with latrophilins (LPHNs/ADGRLs) promotes excitatory synapse formation when LPHNs simultaneously interact with FLRTs. Insertion of a short alternatively-spliced region within TENs abolishes the TEN-LPHN interaction and switches TEN function to specify inhibitory synapses. How alternative-splicing regulates TEN-LPHN interaction remains unclear. Here, we report the 2.9 Å resolution cryo-EM structure of the TEN2-LPHN3 complex, and describe the trimeric TEN2-LPHN3-FLRT3 complex. The structure reveals that the N-terminal lectin domain of LPHN3 binds to the TEN2 barrel at a site far away from the alternatively spliced region. Alternative-splicing regulates the TEN2-LPHN3 interaction by hindering access to the LPHN-binding surface rather than altering it. Strikingly, mutagenesis of the LPHN-binding surface of TEN2 abolishes the LPHN3 interaction and impairs excitatory but not inhibitory synapse formation. These results suggest that a multi-level coincident binding mechanism mediated by a cryptic adhesion complex between TENs and LPHNs regulates synapse specificity.

Introduction

Neural circuit assembly and function in the central nervous system requires precise formation and specification of diverse excitatory and inhibitory synapse subtypes. Imbalances in the ratio of excitatory to inhibitory synapse function are thought to be a major component of brain disorders such as autism, mental retardation, and attention deficit hyperactivity disorder (ADHD)1. Recent work suggested that combinatorial sets of trans-synaptic interactions between cell-adhesion molecules, including teneurins (TENs or ODZs) and latrophilins (LPHNs or ADGRLs), mediate synapse formation and regulate the exquisite specification of synapses, but the underlying molecular mechanisms remain largely unexplored2,3.

TENs and LPHNs are evolutionarily conserved cell-surface proteins. While the roles of TENs and LPHNs in early organisms remain unclear, they have critical roles in embryonic development and brain wiring in higher eukaryotes. TENs (TEN1-4 in mammals) are large type-II transmembrane proteins that are composed of an N-terminal cytoplasmic sequence, a single transmembrane region, and a large extracellular region (ECR) composed of >2000 amino acids with partial homology to bacterial Tc toxins (Fig. 1a)4,5,6,7. They form constitutive cis-dimers via highly conserved disulfide bonds formed in proximity to their transmembrane helix (Fig. 1c)7,8,9. TENs have central roles in tissue polarity, embryogenesis, heart development, axon guidance, and synapse formation6,10,11,12,13,14,15,16,17; and are linked to various diseases including neurological disorders, developmental problems, various cancers, and congenital general anosmia18,19,20,21,22,23,24. LPHNs (LPHN1-3 in mammals) belong to the adhesion-type G-protein coupled receptor (GPCR) family25,26,27 and have a large N-terminal ECR (>800 amino acids) in addition to their signaling seven-pass transmembrane domain and cytoplasmic tail (Fig. 1b)26,28,29,30,31. LPHNs have roles in embryogenesis, tissue polarity, synaptic development, and neural circuit connectivity, interestingly almost identical to the functions of TENs15,16,26,28,29,30,31,32,33 (Fig. 1b). LPHN3 mutations are linked to ADHD, as well as numerous cancers in humans34,35,36.

Fig. 1: The structure of the TEN2/LPHN3 complex.
figure1

a Schematic diagram of human TEN2. Extracellular domains are colored gray, dark blue, sky blue, cyan, and palecyan for domains 1–5, respectively; transmembrane region (TM) in brown. Domain numbers and descriptions are indicated above scheme. b Schematic diagram of human LPHN3. Lec and Olf domain are colored orange; Hormone Receptor (HormR), GAIN and TM domains are colored gray. Splice site of TEN2 and LPHN3 are shown as red star and black stars, respectively. The constructs that were used in structure determination were TEN2 −SS and LPHN3 SS. c Schematic diagram of the interaction network between TEN, LPHN, and FLRT at the synapse. TEN and FLRT are localized on the presynaptic cell membrane, while LPHN is localized on the postsynaptic membrane. TEN2 −SS isoform (empty red star) forms trans-cellular complexes with LPHN3 and induces excitatory postsynaptic specializations when LPHN3 simultaneously binds to FLRT3 (left). In contrast, TEN2 SS isoform (filled red star) induces inhibitory postsynaptic specializations independent of TEN2/LPHN3 interaction or FLRT3 binding (right). df The structure of the TEN2/LPHN3 complex as obtained from single-particle cryo-EM analysis. The Lec domain of LPHN3 binds to the side of the β-barrel of TEN. The alternatively spliced site within the β-propeller domain is distal to the Lec binding site on TEN.

The large ECRs of TENs and LPHNs form a tight trans-cellular adhesion complex6,15,16. The most N-terminal Lectin (Lec) and Olfactomedin (Olf) domains of LPHN interact with TEN2, with the Lec domain contributing most of the binding affinity (Fig. 1b). A four or five amino acid splice insert (MEQK or KVEQK) between these domains decreases the affinity of the TEN/LPHN interaction16. In addition to TENs, LPHNs form trans-cellular interactions also with homodimeric cell-adhesion molecules called fibronectin leucine rich repeat transmembrane proteins (FLRTs), which further interact with Uncoordinated5 (UNC5s)27,37. The LPHN3/TEN2 interaction as well as the LPHN3/FLRT3 interaction were individually reported to be important for synapse formation and organization15,16,37. Recent work showed that in transgenic mice in vivo, postsynaptic LPHN3 promotes excitatory synapse formation by simultaneously binding to TEN and FLRT, two unrelated presynaptic ligands, which is required for formation of synaptic inputs at specific dendritic localizations3. Conversely, LPHN3 deletion had no effect on inhibitory synapse formation3. The precise molecular mechanisms of neither excitatory nor inhibitory synapse formation are known.

In addition to the critical  rol van samenvallende TEN2- en FLRT3-binding aan LPHN3 voor specificatie van exciterende synapsen, alternatieve splicing van TEN2 speelt ook een cruciale rol bij het specificeren van exciterende versus remmende synapsen 2 . Een alternatief gesplitst zeven-residu-gebied (NKEFKHS) binnen TEN2 fungeert als een schakelaar om de transcellulaire adhesie van TEN2 met LPHN’s te reguleren en om verschillende soorten synapsen in vitro te induceren 2 . De TEN2 −SS-splitsingsvariant die de splitsingsinzet mist, kan binden aan LPHN3 in trans (afb. 1c , linkerkant) 2 . Echter, TEN2 SS, de splitsingsvariant die de zeven aminozuren bevat, kan in trans in identieke experimenten niet interageren met LPHN3 (Fig. 1c , rechterkant) 2 . Op dezelfde manier kan dezelfde alternatief gesplitste site ook TEN2 transhomodimerisatie 13 sup >, hoewel dergelijke transhomodimerisatie in sommige assays niet kon worden gedetecteerd 16 . Het moleculaire mechanisme van hoe alternatieve splicing ligand-interacties reguleert is echter onduidelijk.

In overeenstemming met in vivo transgene muizen experimenten, alleen de splitsingsvariant van TEN2 die kan interageren met LPHN3 (TEN2 −SS) was in staat excitatoire synapsen te bevorderen wanneer deze in vitro tot expressie werden gebracht met FLRT3 in gekweekte neuronen 3 . De andere TEN2-splitsingsvariant die niet kan interageren met LPHN3 (TEN2 SS) bevorderde de exciterende synapsvorming niet wanneer deze alleen tot expressie werd gebracht of mede tot expressie werd gebracht met FLRT3 In plaats daarvan, deze door TEN2-isovorm geïnduceerde remmende postsynaptische specificaties op een LPHN-onafhankelijke manier, waarschijnlijk door interactie met andere onbekende liganden, wat suggereert dat alternatieve splitsing van TEN2 exciterende vs. remmende synaps-specificatie reguleert 2 . Deze resultaten duiden op een multi-level coïncidentie signaleringsmechanisme voor de specificatie van synaptische verbindingen die de aanwezigheid vereist van de juiste combinatie van moleculen en hun geschikte alternatief gesplitste isovormen om te colocaliseren om de vorming van een specifiek type synaps te induceren. De moleculaire details van de TEN / LPHN / FLRT-interactie zijn echter niet bekend. Bovendien is de structurele basis voor het ontbreken van de TEN2 / LPHN3 trans interactie in aanwezigheid van een korte splitsingsinzet in TEN2 is onduidelijk.

Hier hebben we de cryo-EM-structuur met een resolutie van 2,9 Å van het TEN2 / LPHN3-complex bepaald en de directe en gelijktijdige interactie van LPHN3 met zowel TEN2 als FLRT3. De complexe structuur van TEN2 / LPHN3 toonde aan dat het N-terminale Lec-domein van LPHN3 een wisselwerking heeft met het β-barrel-domein van TEN2. Zowel de Lec als de voorgaande Olf-domeinen van LPHN3 wijzen weg van de alternatief gesplitste site wit hin het β-propellerdomein van TEN2, wat inderdaad geen verklaring biedt voor hoe de korte lasinzet TEN2 / LPHN3-interactie kan reguleren. Met behulp van een reeks experimentele opstellingen die ofwel trans -cellulaire interacties tussen tegengestelde celmembranen of cis-achtige -interacties in oplossing nabootsen, toonden we dat alternatieve indirecte splitsing van TEN2 indirect reguleert de TEN2 / LPHN3-interactie door de toegankelijkheid van de LPHN-bindingsplaats op TEN2 te veranderen met behulp van membranen, in plaats van rechtstreeks te interfereren met de LPHN-bindingsplaats. Mutagenese van de LPHN-bindingsplaats op TEN2 heft de TEN2 / LPHN3-interactie op en had een ernstig en specifiek effect op de exciterende synapsvorming, maar had geen effect op de remmende synapsvorming. Deze resultaten bieden een moleculair en mechanistisch begrip van het multi-level coïncidentiebindingsmechanisme dat specificiteit bij synapsvorming en circuitbedrading medieert.

Resultaten

Structuur van de TEN2 / LPHN3 complex

Om de structuur van het TEN2 / LPHN3-complex te bepalen, ontbreekt het ECR van menselijk TEN2 zonder de EGF-herhalingen die verantwoordelijk zijn voor cis -dimerisatie (TEN2 -SS ECRΔ1, coderend voor residuen) 727-2648, Fig. 1a ) en het volledige ECR van humaan LPHN3 (LPHN3 SS ECR, coderende residuen S21-V866, Fig. 1b ) waren samen uitgedrukt. De complexe structuur werd bepaald door cryo-EM met één deeltje. Na meerdere rondes van 3D-classificatie werden twee cryo-EM-kaarten verkregen: één overeenkomend met de monomere TEN2 −SS ECRΔ1 in complex met LPHN3 ECR bij een nominale resolutie van 2,9 Å (van 9,7% van de deeltjes, aanvullende figuren 1 – 4 ), en de andere komt overeen met het monomere TEN2 ECRΔ1 met een beter opgelost β-propellerdomein bij een nominale resolutie van 3,0 Å (van 3,8% van de deeltjes) . Een bijna-atomair resolutiemodel van het eiwitcomplex werd gebouwd met behulp van de beschikbare TEN2-structuur (VOB: 6CMX ) en de Lec Olf structuur (VOB: 5AFB ) (figuur 1d , aanvullende figuren. 1 4 , tabel 1 ).

Tabel 1 Cryo-EM-gegevensverzameling, verfijning en validatiestatistieken.
div >

Onze TEN2 / LPHN3-complexe structuur omvat een heterodimeer van ~ 100 × 50 × 115 Å waarin het Lec-domein van LPHN3 interageert met de zijde van het vatdomein van TEN2 (Fig. 1d – f ). De TEN2 ECR is geassembleerd als een grote cilindrische loop die is afgedicht door de β-propeller en Ig-achtige domeinen onderaan; en het toxine-achtige domein steekt uit en hecht zich aan de zijkant van het vat zoals eerder gemeld 2 , 38 . Het Lec-domein van LPHN3 en het toxine-achtige domein van TEN2 binden aan tegenover elkaar liggende vlakken van het β-vat in een schijnbaar parallelle oriëntatie met elkaar (figuur 1d – f ). Er worden geen grote conformationele veranderingen waargenomen wanneer de complexe structuur wordt vergeleken met de individuele structuren van TEN2 of LPHN3.

Analyse van de cryo-EM-kaarten op een lagere drempel onthulde ook een continue dichtheid voor het Olf-domein die zich uitstrekte van het Lec-domein naar de andere kant van het β-propellerdomein van TEN2 (Fig. 2a ). Ondanks de lagere resolutie was het mogelijk om de beschikbare LPHN3 Olf-domeinstructuur in deze dichtheid in te passen (afb. 2b ). Het Olf-domein bevindt zich dicht bij de bovenkant van de TEN2 β-barrel, hoewel het niet in contact staat met TEN2 (Fig. 2b ). De aanwezigheid van de splitsingsinzet (KVEQK) tussen de Lec- en OLF-domeinen in ons LPHN3-construct veroorzaakt waarschijnlijk het gebrek aan interactie van het Olf-domein met TEN. De resterende C-terminale domeinen van LPHN3 for5 die geen EM-dichtheid hebben, strekken zich waarschijnlijk uit vanaf de andere kant, weg van het TEN2 TM -domein dat zich op het TEN2 N-uiteinde bevindt. Deze oriëntatie positioneert het membraan-verankerde TM-domein van LPHN3 aan de andere kant van het membraan-verankerde TM-domein van TEN, en is dus compatibel met een trans -cellulaire interactie van TEN met LPHN (figuur 2c ).

Fig. 2: LPHN3 werkt tegelijkertijd samen met TEN2 en FLRT3.

een C-terminal met continue dichtheid naar het Lec-domein van LPHN3 onthuld door analyse van de cryo-EM-kaarten op een lagere drempel. b Handmatige aanpassing van het Olf-domein vanuit de LPHN3 Lec-Olf-structuur (PDB: 5AFB) in de extra EM-dichtheid. Het lintdiagram van het TEN2 / LPHN3-Lec-complex is cyaan gekleurd en de LPHN3 Lec-Olf-domeinen zijn oranje gekleurd. Lec-domeinen worden over elkaar heen gelegd. c Schematisch diagram van de transcellulaire positionering van het TEN2 / LPHN3-complex; en de vorming van een ternair complex tussen TEN2, LPHN3 en FLRT3. d Superpositie van het TEN2 / LPHN3-Lec-Olf-complex met de LPHN3 / FLRT3-complexe structuur (VOB: 5CMN). De Olf-domeinen zijn over elkaar heen gelegd. TEN2 en LPHN3 zijn respectievelijk cyaan en oranje gekleurd. FLRT3-moleculen in het FLRT3-dimeer zijn magenta en grijs gekleurd. Het tweede LPHN3-molecuul dat mogelijk aan het FLRT3-dimeer is gebonden, wordt niet weergegeven. Een UNC5-molecuul dat mogelijk aan de magenta FLRT3 is gebonden, wordt niet weergegeven. e SD200-formaat-uitsluitingschromatografieprofiel van het TEN2 / LPHN3 / FLRT3-complex (blauwe lijn) in vergelijking met de profielen van individuele eiwitten (gestreepte grijze lijnen) die aantonen dat LPHN3 tegelijkertijd bindt aan TEN2 en FLRT3. Fracties met uitsluiting van grootte worden uitgevoerd op een SDS-PAGE-gel. Drievoudig complex wordt aangegeven met een blauwe pijl. Brongegevens worden geleverd als brongegevensbestand.

LPHN3, TEN2 en FLRT3 vormen een trimeer complex

LPHN-eiwitten zijn betrokken bij heterodimere interacties met TEN’s en FLRT’s en het samenvallen van zowel FLRT’s als TEN’s is vereist voor exciterende synapsvorming (Fig. 1c , links). Bovendien werken FLRT’s samen met UNC5’s en vormen ze homodimers die niet compatibel zijn met hun UNC5-binding. Het is echter onduidelijk of deze interacties compatibel zijn. We hebben dus onderzocht of de TEN2-, LPHN3- en FLRT3-interacties compatibel zijn met elkaar, of met andere woorden, of TEN2, LPHN3 en FLRT3 een trimeer complex kunnen vormen. De beschikbaarheid van de complexe structuren LPHN3 / FLRT3 en van de structuur LPHN3 Lec – Olf stelde ons in staat structuren te vergelijken en de compatibiliteit van de mogelijke interacties tussen TEN, LPHN3 en FLRT3 te voorspellen en te testen 39 . Intrigerend genoeg toonde de superpositie van het Lec-domein van de LPHN3 / FLRT3-structuur met het Lec-domein van de LPHN3 / TEN2-complexe structuur dat FLRT3 en TEN2 binden aan verschillende domeinen op LPHN3 en dat er geen botsingen zijn tussen TEN2 en FLRT3, wat suggereert dat LPHN3 kan bind tegelijkertijd aan TEN2 en FLRT3 (Fig. 2c, d ).

Om te testen of dit model correct is, hebben we FLRT3 LRR, LPHN3 volledige ECR mede tot uitdrukking gebracht, en TEN2 −SS volledige ECR, zuiverde het complex door gelfiltratiechromatografie en analyseerde de fracties met SDS-PAGE (Fig. 2e ). Zowel LPHN3 ECR- als FLRT3 LRR-elutievolumes verschoven naar links in vergelijking met de elutievolumes van de individuele eiwitten. Alle drie de eiwitten elueerden in dezelfde fracties, wat wijst op de vorming van een trimeer TEN2 / LPHN3 / FLRT3-complex (Fig. 2e ). Deze resultaten suggereren dat TEN2 en FLRT3, beide liganden van LPHN3, gelijktijdig kunnen binden aan LPHN3 en in vitro een trimeer complex kunnen vormen, wat de in vivo observaties ondersteunt dat het samenvallen van zowel TEN2 als FLRT3 aan LPHN3 vereist is voor exciterende synapsvorming 3 .

De bindende interface van de TEN2 / LPHN3-complex is geconserveerd

Om geconserveerde en variabele regio’s van de TEN2 β-barrel en de LPHN3 Lec / Olf-domeinen te visualiseren, hebben we de conservering van residuen op de TEN2 / LPHN3-complexe structuur en gekleurde residuen van meest geconserveerd (magenta) tot minst geconserveerd (cyaan) (Fig. 3a ). De interactie-oppervlakken van TEN’s en LPHN’s komen overeen met een van de best bewaarde regio’s (gele ovalen in Fig. 3a ). Omdat het TEN2 β-vat homoloog is aan bacteriële Tc-toxines, analyseerden we ook de conservering tussen bacteriële toxines door de conservering van residuen tussen bacteriële toxines op de homologe bacteriële TcC-toxinestructuur in kaart te brengen (PDB ID: 4O9X) 40 en merkte op dat het identieke oppervlak van bacteriële Tc-toxines niet behouden blijft (aanvullende afbeelding. 5a ). Onze cryo-EM-kaart onthulde dus dat LPHN3 zich bindt aan een zeer geconserveerd oppervlak op de loop van TEN2 dat waarschijnlijk is geëvolueerd om zich te binden aan LPHN’s na divergeren van bacteriële toxines.

Fig. 3: TEN2- en LPHN3-interactie wordt gemedieerd door geconserveerde residuen.

a De TEN2 / LPHN3-bindingsinterface blijft behouden. De structuur van het TEN2 / LPHN3-complex wordt weergegeven in oppervlakrepresentatie waarop de conservering van residuen in kaart wordt gebracht van meest geconserveerd (magenta) tot minst geconserveerd (cyaan) (met behulp van de ConSurf-server 63 ). De LPHN-bindingsplaats op TEN2 en de TEN2-bindingsplaats op LPHN3 zijn aangegeven met gele cirkels. b Ribbon diagram van de TEN2 / LPHN3 heterodimer die de interface tussen TEN2 en LPHN3 laat zien. Een close-up van het bindingsinterface toont voorlopige residuen die betrokken zijn bij waterstofbruggen en zoutbruggen, respectievelijk aangegeven door gele streepjes en rode streepjes. De TEN2-mutatie DHR-mutatie (D1737N, H1738T, R1739T) die de TEN2 / LPHN3 verstoren, wordt weergegeven als sticks. Twee zoutbruggen tussen R44 en E2001; twee tussen D49 en R2043; een tussen D49 en R2043; en een tussen D67 en K1712 wordt waargenomen. c Close-up van de EM-dichtheid die de dichte pakking toont van de geconserveerde N-gekoppelde glycosylering op TEN2-N1681 met LPHN3-S38 op het Lec-domein. Vanwege de onzekerheid van de glycantopologie hebben we alleen de eerste drie suikers van N-glycosylering (NAG-NAG-BMA) in de dichtheid gemodelleerd.

Het Lec-domein van LPHN3 behoort tot de zee-egelei-lectine (SUEL) -gerelateerde Lec-familie. Het heeft een niervorm met afmetingen van 20 Å × 20 Å × 50 Å en is samengesteld uit vijf β-strengen en een enkele alfa-helix, onderling verbonden door vier geconserveerde disulfidebindingen 41 . In onze kaart was het Lec-domein niet zo goed opgelost als TEN2 (aanvullende figuren 1d , 4c ). Daarom werd de kristalstructuur van het Lec-domein aangemeerd als een stijf lichaam zonder de zijketens te passen. Het koppelen van de complementaire oppervlakken van de β-sandwich van het LPHN3 Lec-domein aan het concave oppervlak van de TEN2 β-barrel creëert een gemiddeld interfaceoppervlak van 690 Å 2 . De hoge affiniteit van het TEN2 / LPHN3-complex wordt bereikt door een combinatie van voorlopige interacties, bestaande uit zoutbruggen, waterstofbruggen en elektrostatische interacties op lange afstand (Fig. 3b ). Met name zoutbruggen aan de boven-, midden- en onderkant van de interface stabiliseren de interactie (Fig. 3b ). Het uitgebreide netwerk van zoutbruggen helpt waarschijnlijk bij het bereiken van de hoge affiniteit van het TEN2 / LPHN3-complex. Bovendien spelen twee residuen op TEN2 (D1737 en H1738) een belangrijke rol door interactie met een disulfidebinding (C36, C66) en D67 van het Lec-domein (Fig. 3b ). Interessant is dat de cryo-EM-kaart een duidelijke dichtheid liet zien van het Lec-domein dat in wisselwerking staat met een glycan afkomstig van glycosylering op N1681 (Fig. 3c ). De glycan wordt ingevoegd in een goed geconserveerde suikerbindende pocket van het SUEL-gerelateerde Lec-domein van LPHN3 (aanvullende afbeelding 5b ), wat suggereert dat in tegenstelling tot eerdere begrippen 41 kan het Lec-domein van LPHN3 mogelijk nog steeds koolhydraten binden.

Om de interactie van TEN2 met LPHN3 specifiek af te schaffen en de geldigheid van de binding te bevestigen Als interface die we waarnamen in de TEN2 / LPHN3 complexe structuur, ontwierpen we mutaties op TEN2 van volledige lengte die slechts een paar atomen op het eiwitoppervlak veranderen. Er zijn verschillende TEN2-mutaties ontworpen, waaronder de DHR (D1737N, H1738T, R1739T) -mutatie die residuen op de LPHN3 Lec-domeinbindende interface verandert (figuur 3b ). Om er zeker van te zijn dat de mutante eiwitten op de juiste manier zijn gevouwen, hebben we eerst de expressieniveaus en het oppervlaktetransport van alle TEN2-mutanten onderzocht en uitsluitend mutanten gebruikt die geen lokalisatieproblemen hadden (aanvullende figuur 5c ). Niet-doorlaatbare HEK293T-cellen getransfecteerd met TEN2-constructen werden gekleurd met een antilichaam dat geschikt was om te reageren met een extracellulaire tag op de eiwitten, en de hoeveelheid aan het oppervlak blootgestelde TEN2 werd beoordeeld door indirecte immunofluorescentie. Belangrijk is dat de DHR-mutant correct was gevouwen en naar het celoppervlak werd overgebracht. Bindingsexperimenten toonden aan dat de DHR-mutant niet in staat is tot interactie met LPHN3. De resultaten van het bindende experiment worden hieronder in detail besproken in de context van geometrische beperkingen die inwerken op de TEN2 / LPHN3-interactie (zie hieronder).

LPHN-bindingsplaats is weg van de splitsingsplaats op TEN

Een alternatief gesplitste site van zeven aminozuren op het β-propellerdomein van TEN2 reguleert de TEN2 / LPHN3-interactie, en bijgevolg exciterende versus remmende synapsvorming 2 . Een opvallende observatie van de TEN2 / LPHN3-complexe structuur was dat de LPHN3-bindingsplaats op TEN2 zich distaal bevindt ten opzichte van de alternatief gesplitste sequentie in de TEN2 β-propeller (Fig. 1 d – f, 42 , 43 . In het geval van de TEN2 / LPHN3-interactie reguleert alternatieve splicing deze interactie op afstand op een manier die voorheen niet werd beschreven.

We veronderstelden dat de membranen van twee tegenover elkaar liggende cellen een dockinggeometrie kunnen opleggen aan TEN2 en LPHN3 die cruciaal is voor hun trans -cellulaire adhesie in de extracellulaire ruimte tussen de membranen, en dat alternatieve splicing zou de dockinggeometrie van TEN2 kunnen beheersen. Bijgevolg kan LPHN3 met een gewijzigde geometrie mogelijk geen toegang krijgen tot de bindingsplaats op TEN2. Deze hypothese suggereert dat het inbrengen of verwijderen van de alternatief gesplitste sequentie geen invloed heeft op het LPHN3-bindingsoppervlak op TEN2 Het suggereert ook dat wanneer een of meer membranen uit het experimentele systeem worden verwijderd, LPHN3 en TEN2 met elkaar zouden interageren, onafhankelijk van alternatieve splicing, omdat ze niet worden beperkt door de membranen waaraan ze zijn verankerd. zijn hypothese hebben we verschillende experimentele opstellingen ontworpen waarin de beperkingen die inwerken op de koppelingsgeometrieën van TEN2 en LPHN3 variëren van hoog tot laag (Fig. 4 ).

Fig. 4: Experimentele opstellingen om het effect van verschillende beperkingen te onderzoeken.

Drie experimentele opstellingen met afnemende beperkingen op de dockgeometrie van LPHN3 en TEN2 tijdens hun interactie. een opstelling voor transcellulaire interactie van TEN2 van volledige lengte met LPHN3 van volledige lengte in experimenten met celaggregatie. Beide eiwitten zijn verankerd op de celmembranen en hun mobiliteit wordt beperkt door hun laterale diffusie binnen het membraan. b Opstelling voor cis-achtige interactie van TEN2 van volledige lengte en oplosbaar gebiotinyleerd Lec-domein van LPHN3 in flowcytometrie of celoppervlakkleuringsexperimenten. TEN2 is verankerd op het celmembraan, maar het Lec-domein van LPHN3 draait vrij in oplossing. c Opstelling voor experimenten in oplossing voor cis-achtige interactie van oplosbare TEN2 en oplosbare LPHN3 zonder membranen.

Eerst hebben we celaggregatietesten uitgevoerd met HEK293-cellen waarin een populatie van HEK-cellen die TEN2 van volledige lengte tot expressie brengen, wordt gemengd met een andere populatie van HEK-cellen die LPHN3 van volledige lengte tot expressie brengen, en celaggregatie wordt gecontroleerd als een functie van TEN2 / LPHN3 interactie (Fig. 4a ). Deze experimenten bootsen trans -cellulaire interactie na doordat ze de binding detecteren van twee eiwitten van volledige lengte die zijn verankerd op tegenoverliggende celmembranen (hierna trans genoemd). Celaggregatie-experimenten leggen hoge beperkingen op aan de dokgeometrieën van de eiwitten omdat beide eiwitten slechts zijdelings in twee dimensies binnen het vlak van de membraandubbellaag kunnen diffunderen. De celaggregatie-experimenten zijn de beste imitatie voor de in vivo interactie van TEN2 en LPHN3, waarbij eiwitten van volledige lengte zich op de celoppervlakken van naburige cellen bevinden tijdens ontwikkeling of synapsvorming. Ten tweede gebruikten we flowcytometrie-experimenten en celoppervlakkleuringsexperimenten waarin de binding van een oplosbaar eiwit aan een membraanverankerd eiwit wordt getest (hierna c is-achtig genoemd, hoewel dit niet mag verward worden met veelgebruikte betekenissen van cis ) (Fig. 4b ). Oplosbare fragmenten van de LPHN3 ECR werden getest op hun vermogen om te binden aan HEK293T-cellen die TEN2 van volledige lengte tot expressie brengen op het celoppervlak. Deze experimenten passen tussenliggende beperkingen toe op de dockinggeometrieën van de eiwitten omdat de membraanverankerde TEN2 slechts zijdelings in twee dimensies binnen het vlak van de membraan dubbellaag kan diffunderen, terwijl het oplosbare LPHN3 ECR-fragment vrij in drie dimensies in oplossing kan diffunderen (Fig. 4b ). Ten derde hebben we grootte-uitsluitingschromatografie gebruikt waarbij de binding van twee oplosbare eiwitten geen beperkingen kent. Hier wordt de binding van de ECR’s van TEN2 en LPHN3 getest in afwezigheid van membranen (ook wel cis-achtig genoemd) (Fig. 4c ). Belangrijk is dat alle intrinsieke beperkingen die afkomstig kunnen zijn van de intrinsieke conformatie van de eiwitten nog steeds kunnen werken op een van de bovenstaande experimenten. We hebben een combinatie van deze experimentele opstellingen gebruikt om het effect van verschillende beperkingen op het vermogen van TEN2 om met LPHN3 te communiceren te onderzoeken.

We hebben twee sets TEN2-constructen in deze experimentele opstellingen onderzocht: (i) TEN2 −SS met LPHN3-bindingsplaatsmutaties (TEN2 −SS DHR) werd vergeleken met WT TEN2 −SS om het effect van LPHN-bindingsplaatsmutaties op de TEN2 / LPHN3-interactie te observeren (Fig. 5a ). We verwachten dat deze mutant de TEN2 / LPHN3-interactie in alle experimentele opstellingen zou moeten afschaffen omdat het de LPHN-bindingsplaats op TEN direct verstoort. (ii) WT TEN2 SS werd vergeleken met WT TEN2 −SS om het effect van opname van de splitsingsinzet op TEN2 / LPHN3-interactie te observeren (Fig. 6a ). We verwachten dat, als de opname van de alternatieve splitsingsinzet de bindingsinterface op TEN2 voor LPHN3 verstoort, de TEN2 SS-variant LPHN3 in geen van de experimentele opstellingen mag binden. Als het inbrengen van het alternatieve lasinzetstuk echter door een ander mechanisme werkt, zoals het wijzigen van de dockgeometrie van TEN2 op LPHN3, dan kan de TEN2 SS-isovorm LPHN3 binden in cis-achtige opstellingen waarbij bindende beperkingen op TEN2 en LPHN3 zijn versoepeld (Fig. 4b, c ).

Fig. 5: Bindingsplaatsmutaties op TEN2 schaffen LPHN3-binding in zowel trans als cis-achtig af.

een diagram voor WT TEN2 −SS en TEN2 DHR −SS constructen. DHR-mutatie (D1737N, H1738T, R1739T) bevindt zich op het TEN2 β-vat op de LPHN3-bindende interface (zwarte stippen). Resultaten voor TEN2- en LPHN3-binding in verschillende experimentele opstellingen (Fig. 4a–c ) worden samengevat in de tabel. De DHR-mutatie verbreekt de interactie van TEN2 met LPHN3 in alle experimentele opstellingen. b Representatieve afbeeldingen voor celaggregatietests met TEN2-constructen en LPHN3 van volledige lengte. WT TEN2 −SS induceert celaggregatie met LPHN3, terwijl TEN2 DHR −SS celaggregatie opheft. HEK293-cellen werden gecotransfecteerd met TEN2 of LPHN3 en ofwel tdTomato of EGFP zoals aangegeven. Schaalbalk geeft 100 µm aan. Kwantificering van aggregatie-index (%) wordt rechts weergegeven (*** p c TEN2-constructen die tot expressie zijn gebracht in zoogdiercellen werden getest op hun vermogen om oplosbaar gebiotinyleerd LPHN3- of LPHN1-Lec-domein te binden met behulp van flowcytometrie-experimenten (links) of celoppervlakkleuringstesten (rechts). De DHR-mutatie heft de cis-achtige interactie tussen TEN2 en LPHN op. TEN2-constructexpressie werd bepaald door HA-tagfluorescentie ( Y -as) en gezuiverde Lec-binding aan TEN2-tot expressie brengende cellen werd gemeten door fluorescentie van DyLight gehecht aan neutravidine ( X -as). Dot plots geven de correlatie weer tussen TEN2-expressie en LPHN3-binding. Een zwart kruis geeft de poort “hoge TEN2-expressie en hoge LPHN3-binding” aan. Schaalbalk geeft 20 µm aan. Kwantificering van celoppervlakbindingsassays wordt naast de afbeelding weergegeven (*** p d Chromatogrammen met uitsluiting van grootte die de vorming van een binair complex tussen oplosbare TEN2 -SS ECRΔ1 en volledige LPHN3 ECR laten zien (linker, zwarte lijn). Afzonderlijke eiwitten worden weergegeven als controle (stippellijnen). LPHN-bindende mutant bindt niet aan LPHN3 ECR (rechter, groene lijn), zoals waargenomen door het ontbreken van co-elutie in fracties die op SDS-PAGE werden uitgevoerd. De kleuren van de chromatogrammen en de dozen rond de gels komen overeen. Gegevens in b en c worden gepresenteerd als gemiddelde ± SEM, n = 3, en zijn representatief voor ten minste drie onafhankelijke experimenten. Brongegevens worden geleverd als een brongegevensbestand.

Fig. 6: Membraanverankering beperkt alternatieve splitsingsafhankelijke interactie van TEN2 met LPHN3.

Dezelfde drie experimentele opstellingen zoals in Fig. 4a – c werden gebruikt om het effect van alternatieve splicing op TEN2 te testen / LPHN3 interactie. Figuuroverzicht is in principe identiek aan dat van Fig. 5 . een diagram voor WT TEN2 −SS- en WT TEN2 SS-constructen die in de onderstaande experimenten zijn gebruikt. De plaats van de zeven aminozuren op de TEN2 β-propeller wordt aangegeven door lege of gevulde rode sterren. Resultaten voor de interactie van TEN2 en LPHN3 in verschillende experimentele opstellingen (zoals in Fig. 4 a – c en 5b – d ) worden samengevat in de tabel. Het inbrengen van de splitsingsplaats verbreekt de interactie van TEN2 met LPHN3 alleen in de celaggregatietests, maar niet in de andere experimentele opstellingen. b Representatieve afbeeldingen voor celaggregatietests met TEN2 −SS of TEN2 SS en LPHN3 van volledige lengte. TEN2 −SS induceert celaggregatie met LPHN3, terwijl TEN2 SS celaggregatie afschaft. Schaalbalk geeft 100 µm aan. Figuur gewijzigd van ref. 2 . c TEN2 −SS en TEN2 SS uitgedrukt in zoogdiercellen werden getest op hun vermogen om oplosbaar gebiotinyleerd LPHN3- of LPHN1 Lec-domein te binden met behulp van flowcytometrie-experimenten (links) en met celoppervlakkleuringstesten (rechts) . Zowel −SS als SS bemiddelen de interactie tussen TEN2 en LPHN in cis-achtige . Kwantificering van celoppervlakbindingsassays wordt naast de afbeelding weergegeven. De celoppervlakkleuringstests in c werden uitgevoerd in hetzelfde experiment als in figuur 5c , en dus zijn de besturingsafbeeldingen identiek. Schaalbalk geeft 20 µm aan. (*** p d Grootte-uitsluitingschromatogrammen die de vorming van binaire complexen tonen tussen oplosbare volledige TEN2 ECR en volledige LPHN3 ECR (links , blauwe en groene lijnen). Elutieprofiel voor individuele TEN2 −SS ECR, TEN2 SS ECR en LPHN3 ECR worden ter referentie weergegeven (grijze lijnen). Zowel TEN2 −SS ECR als TEN2 SS ECR binden aan LPHN3 ECR (respectievelijk groene en blauwe lijnen), zoals ook waargenomen door co-elutie in de fracties, uitgevoerd op SDS-PAGE-gel. De kleuren van de chromatogrammen komen overeen met de kleuren van de doos rond de SDS-PAGE-gel. Gegevens in b en c worden gepresenteerd als gemiddelde ± SEM, n = 3, en zijn representatief voor ten minste drie onafhankelijke experimenten. Brongegevens worden geleverd als een brongegevensbestand.

De eerste reeks experimenten die het effect van puntmutaties op het LPHN3-bindende oppervlak testten, toonde aan dat TEN2 -SS DHR-mutant kon niet binden aan LPHN3 in alle experimentele opstellingen, inclusief celaggregatie-experimenten (Fig. 5b ), flowcytometrie-experimenten (Fig. 5c , links) , celoppervlakkleuringsexperimenten (Fig. 5c , rechts) en gelfiltratie-experimenten (Fig. 5d ). Deze resultaten tonen aan dat deze mutatie de bindingsinterface op TEN2 voor LPHN3 vernietigt en complexe vorming in trans en cis-achtige opheft (Fig. 5 ). De tweede reeks experimenten die het effect van de alternatief gesplitste sequentie van TEN2 op LPHN3-binding testten, vertoonde echter differentiële effecten in trans en cis-iike experimentele opstellingen (Fig. 6 ). In experimenten met celaggregatie veroorzaakte TEN2 van volledige lengte zonder de β-propeller-splitsing een robuuste trans -cellulaire aggregatie met LPHN3 van volledige lengte (Fig. 6b ). Intrigerend, zoals we eerder hebben laten zien, elimineerde opname van de zeven aminozuur-splitsingsinzet in de β-propeller de transcellulaire adhesie met LPHN3 (Fig. 6b ). In flowcytometrie-experimenten werd de affiniteit van TEN2 voor het oplosbare Lec-domein (dat niet aan de membranen is gehecht) echter niet beïnvloed door het invoegen van het zeven-residu-segment (Fig. 6c , links). Celoppervlakkleuringsexperimenten toonden ook aan dat het oplosbare Lec-domein van LPHN3 bindt aan beide TEN2-splitsisovormen, wat de flowcytometrie-experimenten bevestigt (Fig. 6c , rechts). Tenslotte toonden gelfiltratiechromatografie-experimenten uitgevoerd met de volledige lengte van TEN2- en LPHN3-ECR’s als oplosbare eiwitten die niet aan membranen waren gehecht, aan dat, wanneer er geen beperkingen op TEN2 en LPHN3 worden toegepast, beide TEN2-isovormen voor splitsingen een sterke interactie met LPHN3 vertoonden (figuur 6d ). Daarom suggereren we dat trans -cellulaire TEN2-LPHN3-interacties worden gereguleerd door β-propeller alternatieve splicing waarschijnlijk als gevolg van conformationele beperkingen in de context van volledige eiwitten.

Bindende mutanten schaffen exciterende synapsvorming af

Eerder werk toonde aan dat de splitsisovormen van TEN2 (TEN2 SS en TEN2 −SS) verschillende synaptische specificaties induceren in kunstmatige synapsvormingsassays. In deze assays werden HEK293-cellen die TEN2-varianten tot expressie brengen, samen gekweekt met primaire neuronen; en remmende en exciterende synapsvorming werd gecontroleerd op pre- en postsynaptische differentiatie voor beide soorten synapsen 2 . De resultaten toonden aan dat TEN2 SS GABAergische (remmende) postsynaptische specialisaties induceerde, maar geen glutamaterge (exciterende) postsynaptische specificaties induceerde 2 . Aan de andere kant slaagde TEN2 −SS er aanvankelijk niet in om zowel exciterende als remmende synaptische markers te rekruteren 2 . Echter, toen FLRT3, een ander LPHN3-ligand dat op zichzelf ook niet in staat is pre- of postsynaptische specialisaties te induceren, in HEK293-cellen tot expressie werd gebracht met de TEN2 -SS, veroorzaakten deze moleculen samen krachtig opwindende maar niet remmende postsynaptische specialisaties 3 (Fig. 1c , linkerkant). p>

Aangezien alleen de TEN2 −SS isovorm interactie kan aangaan met LPHN3 in een trans -configuratie, speculeerden we dat de DHR mutatio n dat de interactie van TEN2 met LPHN3 door het slopen van de bindingsplaats opheft, zou de exciterende synapsvorming moeten beïnvloeden, maar mag de remmende synapsvorming die wordt gemedieerd door de TEN2 SS-isovorm niet belemmeren omdat remmende synapsvorming onafhankelijk is van de TEN2 / LPHN3-interactie. Om deze hypothese te testen, hebben we de DHR-mutatie ontwikkeld op zowel de volledige TEN2 −SS- als de TEN2 SS-isovormen, en het effect ervan getest op de inductie van exciterende (−SS-variant) of remmende ( SS-variant) postsynaptische specialisaties in de kunstmatige synapsvormingstest (Fig. 7a ). Zoals eerder aangetoond, veroorzaakten WT TEN2 −SS prikkelende postsynaptische specialisaties wanneer ze tot expressie werden gebracht met FLRT3 (Fig. 7b, c ); en WT TEN2 SS veroorzaakte remmende postsynaptische specialisaties (Fig. 7d, e ) 2 , 3 . We zagen dat de DHR-mutant de vorming van exciterende synapsen verzwakte in vergelijking met wildtype TEN2 −SS (Fig. 7b, c ). Echter, dezelfde mutant veroorzaakte remmende postsynaptische specialisaties vergelijkbaar met die van de wild-type TEN2 SS (Fig. 7d, e ), zoals voorspeld. Deze resultaten geven aan dat LPHN3-binding de exciterende synapsvorming van TEN2 −SS medieert, terwijl binding van LPHN3 aan TEN2 niet betrokken is bij remmende synapsvorming.

Fig. 7: Bindingsplaatsmutaties op TEN2 heffen selectief exciterende maar niet remmende synapsvorming op.

een diagram voor TEN2 DHR −SS- en TEN2 DHR SS-constructen die in de onderstaande experimenten werden gebruikt. De splitsingsplaats van zeven aminozuren op de TEN2 β-propeller wordt aangegeven door lege of gevulde rode sterren; DHR-mutatie wordt aangegeven door zwarte stippen. b , c Test voor kunstmatige synapsvorming die aantoont dat LPHN-bindende mutant (DHR) van TEN2 -SS de vorming van exciterende synaps verzwakte. HEK293T-cellen worden gecotransfecteerd met aangegeven celadhesiemoleculen en GFP, en gecultiveerd met corticale neuronen. Culturen werden vervolgens immunogekleurd voor de exciterende postsynaptische synapsmarker PSD95. Representatieve afbeeldingen ( b ) en kwantificeringen van PSD95-signalen ( c ) worden getoond. d , e LPHN-bindende mutant (DHR) van TEN2 SS had geen invloed op de remmende synapsvorming. Vergelijkbaar in b en c , behalve dat immunokleuring voor de remmende postsynaptische synapsmarker GABA (A) α2 werd uitgevoerd. Schaalbalk in b en d geeft 10 µm aan. Gegevens in c en e worden gepresenteerd als gemiddelde ± SEM, n = 3, en zijn representatief voor ten minste drie onafhankelijke experimenten. ns, P > 0,05; * P

Discussie

Teneurins en latrophilins zijn multifunctionele transmembraaneiwitten die via transcellulaire belangrijke biologische rollen vervullen interacties. De functie van LPHN3 bij exciterende synapsvorming vereist gelijktijdige binding van LPHN3 aan zowel TEN’s als FLRT’s, wat suggereert dat een coïncident signaleringsmechanisme de specificiteit van synaptische verbindingen medieert. Synaptische specificiteit wordt verder gereguleerd door alternatieve splitsing van TEN2 omdat alleen de LPHN3-bindende splitsingsvariant van TEN2 exciterende synapsen kan induceren, maar niet de andere variant die remmende synapsen induceert die waarschijnlijk op een LPHN3-onafhankelijke manier zijn. Een moleculair begrip van het TEN2-LPHN3-complex en de kritische regulering ervan door alternatieve splicing om exciterende vs. remmende synapsspecificatie te specificeren, is essentieel voor vooruitgang bij het begrijpen van synapsvorming.

Hier hebben we de cryo-EM-structuur van het LPHN3-TEN2-complex dat onthulde dat het N-terminale Lec-domein van LPHN3 bindt aan de zijde van het TEN2-vat tegenover het toxine-achtige domein (Fig. 1d – f ). Eerder rapporteerden we dat het toxine-achtige domein van TEN2 nodig is voor LPHN3-binding omdat een toxinedomein-deletieconstruct (TEN2 ΔTox) Lec-binding in celaggregatie en celoppervlakkleuringsexperimenten ophief en geen defecten in celoppervlaklokalisatie miste. 2 . Onze verdere experimenten suggereerden dat deze mutant niet in staat is om LPHN te binden, waarschijnlijk omdat hij verkeerd is gevouwen en ontsnapt aan het systeem voor kwaliteitscontrole van proteïnen en nog steeds naar het celoppervlak werd overgebracht (aanvullende figuren 6 en 44 . Beide structuren zijn het erover eens dat LPHN aan de zijkant van het TEN2-vat bindt en niet aan het toxinedomein. Het nabijgelegen Olf-domein van LPHN3 wijst weg van het N-uiteinde van TEN2, waardoor de membraanverankerde domeinen van LPHN3 en TEN2 tegenover elkaar worden geplaatst, consistent met een transcellulaire interactie in plaats van cis (figuur 2 ). Een FLRT3-molecuul kan tegelijkertijd binden aan het Olf-domein van LPHN3 en een trimeer TEN2-LPHN3-FLRT3-complex vormen (afb. 2 ). Of het trimeer de binding van een tweede FLRT3-molecuul kan accommoderen om FLRT3-dimerisatie of binding van een mogelijk te maken  UNC5-molecuul op het FLRT-monomeer kan afhangen van de alternatief gesplitste sequentie van LPHN3 tussen de Lec- en Olf-domeinen. FLRT3-dimerisatie of de FLRT3 / UNC5-interactie kan leiden tot verdere herschikking van het eiwit-eiwit-interactienetwerk bij de synaps.

Belangrijk is dat de complexe structuur van LPHN3 – TEN2 onthulde dat de LPHN3-bindende site op TEN2 weg is van de alternatief gesplitste site die zich op de TEN2-propeller bevindt (Fig. 1 3 ), wat de vraag oproept hoe een splitsing van zeven aminozuren in de> 2000 aminozuur ECR van TEN2 zou LPHN3-binding en synaps-specificiteit kunnen dicteren zonder dicht bij het bindende grensvlak te zijn. De kristalstructuur van de TEN2 SS-isovorm toonde aan dat het lasinzetstuk op de kristalcontactplaats ligt en waarschijnlijk TEN-homodimerisatie medieert (Fig. 8a ) 38 . Alternatieve splitsing in het coderende gebied van eiwitten vergroot de functionele en regulerende capaciteit van metazoea genomen genomen 45 , 46 , 47 , 48 . Naast TEN2 gebruiken talloze eiwitten zoals DSCAM’s, protocadherines, neurexins en neuroligins alternatieve splicing om hun functies te diversifiëren, zoals hun vermogen om liganden te binden 49 , 50 , 51 , 52 . In de meeste eiwitten lokaliseren de alternatief gesplitste sites zich naar de ligandbindende site om ligandbinding direct mogelijk te maken of te verstoren 42 , 43 , 53 . Het is dus ongebruikelijk dat de LPHN3-bindingsplaats is gelokaliseerd weg van de alternatief gesplitste sequentie. In het geval van TEN2 maakt alternatieve splicing het mogelijk het eiwit om te fungeren als een schakelaar bij het reguleren van ligandbinding ondanks het feit dat de ligandbindingsplaats weg is van de zeven residu alternatief gesplitste plaats 2 , en deze schakelaar schakelt LPHN3-binding uit die nodig is voor exciterende synapsvorming, terwijl het waarschijnlijk (een) andere interactie (s) vereist voor remmende werking mogelijk maakt synapsvorming.

Fig. 8: Als alternatief gesplitst inzetstuk in de β-propeller bemiddelt de TEN2 SS-dimerinterface.

a Structuur van TEN2 SS-dimeer toont de splitsinserts van elk protomeer (gele en magenta resten) creëert een bindende interface en leidt tot TEN2-dimerisatie via de β-propeller. Close-upaanzichten van de dimeerinterface tonen twee zoutbruggen en vijf waterstofbruggen bevinden zich op de interface. Een van de zoutbruggen wordt direct gemedieerd door het glutamaat (E1306) in de splitsingsinzet NK E FKHS en vier van de waterstofbruggen vereisen ook residuen van de splitsingsplaats. Twee zoutbruggen liggen bijna parallel aan elkaar en aan de disulfidebindingen tussen de EGF-herhalingen en beperkt de conformationele flexibiliteit van de TEN2-kop aanzienlijk (zie Fig. 9 ). De N-uiteinden van beide protomeren zijn in dezelfde richting gericht naar de EGF-herhalingen, en dus is het dimeer gepositioneerd als een cis-dimeer dat de ritssluiting van het reeds bestaande EGF-gemedieerde cis-dimeer zal verlengen, hoewel werd gemeld dat het als trans-homodimer, voorheen 38 . TEN-protomeren (VOB: 6FB3) zijn gekleurd als respectievelijk cyaan en palegreen, en splitsingsplaatsen zijn gekleurd als respectievelijk geel en magenta. b Experimenten met celaggregatie tonen aan dat het LPHN3-bindende vermogen van TEN2 SS gedeeltelijk wordt hersteld wanneer de twee zoutbruggen worden verbroken in de TEN2 SS-mutant (* P ≤ 0,05; *** P ≤ 0,001; door eenrichtings-ANOVA). Gegevens worden gepresenteerd als gemiddelde ± SEM, n = 3, en zijn representatief voor ten minste drie onafhankelijke experimenten. Brongegevens worden geleverd als een brongegevensbestand.

Hoewel het intuïtief moeilijk is om de relatie tussen alternatieve splicing en LPHN3-binding te begrijpen, hebben onze experimenten met synapsvorming aangetoond een duidelijke vereiste van TEN2-LPHN3-interactie voor de exciterende synapsspecificatiefunctie van TEN2 -SS, aangezien de DHR-mutatie op TEN2 -SS-isovorm die niet aan LPHN3 kan binden, geen exciterende postsynaptische specialisaties kon induceren (figuur 7b , c ). Dezelfde mutatie op de TEN2 SS-isovorm gedroeg zich echter als wildtype TEN2 SS en veroorzaakte met succes remmende synapsvorming (Fig. 7d, e ). Deze resultaten suggereren dat interactie van TEN2 met LPHN3 vereist is voor exciterende maar niet voor remmende synapsvorming. Bovendien suggereert de observatie dat de DHR LPHN-bindende mutant geen effect had op het vermogen van TEN2 SS om remmende postsynaptische specialisaties te induceren, een LPHN-onafhankelijk mechanisme dat niet-geïdentificeerde TEN2-interactiepartners vereist bij remmende synapsen.

Onze resultaten tonen aan dat de interactie van LPHN3 met TEN2 op ten minste twee manieren kan worden verstoord: (1) door puntmutaties op de LPHN-bindende interface op TEN2 (maar niet door mutaties die niet aan de interface zijn, aanvullende figuur. 6 ), en (2) door insertie van de zeven alternatief gesplitste residuen in het propellerdomein van TEN2. De mutagenese van de LPHN-bindende interface maakte een einde aan de TEN2 / LPHN3-interactie in alle experimentele opstellingen zoals verwacht van een mutatie op de bindingsplaats (Fig. 5 ). Het effect van een alternatief gesplitste plaats op de TEN2 / LPHN3-interactie was echter afhankelijk van het feit of één of beide eiwitten beperkingen ondervonden vanwege hun hechting aan celmembranen; of ze kunnen vrij roteren en tuimelen in oplossing (Fig. 6 ). In het bijzonder schafte alternatieve splicing de TEN2 / LPHN3-interactie af in experimenten met celaggregatie waarbij eiwitten elkaar benaderen vanuit tegengestelde membranen; maar niet bij celoppervlakkleuring of experimenten in oplossing waarbij een of meer eiwitten in oplossing zijn. Al met al suggereren deze resultaten dat alternatieve splicing de TEN2 / LPHN3-interactie reguleert via een mechanisme dat verschilt van het verstoren van de bindingsinterface. Deze resultaten stellen ons in staat om een ​​model te suggereren voor hoe alternatieve splicing TEN2-interacties en -functies reguleert:

TEN2 vormt een cis-dimeer op het presynaptische membraan dat wordt gemedieerd door twee disulfidebindingen gevormd tussen de 2e en 5e EGF-herhaling (zwarte lijnen, Fig. 9 ) die de bolvormige cytoplasmatische C-terminale koppen van TEN2 (TEN2 ECRΔ1) uitstrekken naar het tegenoverliggende membraan (Fig. 8 , 2 en om met succes het Lec-domein van LPHN3 te binden in cis-achtige en trans i> (Afb. 9a ). In deze conformatie is FLRT3 ook in staat om te interageren met LPHN3 en een trimeer complex te vormen, wat leidt tot exciterende synapsvorming (Fig. 9a ). De kristalstructuur van de TEN2 SS-isovorm toonde echter aan dat, in de aanwezigheid van de lasinzet, de twee bolvormige koppen een dimeer vormen dat wordt vergemakkelijkt door de interacties tussen de lasinzetstukken (afb. 8a a >). De aanwezigheid van de splitsinserts maakt de vorming mogelijk van twee zoutbruggen (E1306-H1315 en E1301-R1337 in kip Ten2, rode stippellijnen in Fig. 8a en zwarte ballen in Fig. 9b ) en vijf waterstofbruggen tussen de β-propellers. Deze nieuw gegenereerde interacties van de propellerdomeinen zouden het molecuul dichtritsen en stijfheid introduceren in de TEN2 SS cis-dimeer en de rotatieflexibiliteit rond de EGF / koplinker beperken, waardoor wordt voorkomen dat TEN2 SS de 3D-ruimte bemonstert (Fig. 9b ). Aan de andere kant bestaat de ECR van LPHN3 uit twee bolvormige regio’s, gescheiden door een Ser-Thr-Pro-rijk geglycosyleerd linkergebied dat naar verluidt semi-rigide 54 . Als resultaat zou het Lec-domein van LPHN3 op het tegenoverliggende membraan beperkte of geen toegang hebben tot de LPHN-bindingsplaats op TEN2 SS en niet binden, hoewel de bindingsplaats intact en functioneel is. Om de validiteit van dit model te testen, hebben we mutaties geïntroduceerd om de twee zoutbruggen die nieuw zijn gegenereerd in de TEN2 SS-vorm (E1154A, H1161A, R1183A, E tot A in menselijke TEN2-splitsingsplaats NK E FKHS) en om de stijfheid te verminderen die wordt geïntroduceerd door de splitsingsinzet van zeven aminozuren (Fig. 8a ). Celaggregatie-experimenten toonden aan dat de TEN2 SS-zoutbrugmutant het LPHN3-bindingsvermogen van TEN2 SS gedeeltelijk herstelde (afb. 8b ), wat suggereert dat de stijfheid geïntroduceerd door de zoutbruggen die gevormd worden bij het inbrengen van de splitsingssite beperkt de toegankelijkheid van TEN2 tot LPHN3.

Fig. 9: Model voor de splitsingsvariant-afhankelijke interactie van TEN2 met LPHN3.

Het model laat zien hoe alternatieve splicing werkt als een moleculaire schakelaar om te bepalen aan welke adhesiepartner TEN2 bindt en, dienovereenkomstig, welk type synaps TEN2 specificeert. Beide TEN2-isovormen vormen een cis-dimeer op het presynaptische membraan door middel van twee disulfidebindingen gevormd tussen de 2e en 5e EGF-herhaling (zwarte stokjes). een TEN2 −SS isovorm heeft rotatieflexibiliteit (pijlen) waardoor TEN2 de juiste dockinggeometrie kan vinden om te binden aan het Lec-domein van LPHN3 uitgedrukt op de naburige cel 2 . Een dergelijke rotatieflexibiliteit stelt FLRT3 ook in staat te binden aan het Olf-domein van LPHN3 en, in totaal, exciterende synapsvorming te induceren. De DHR-mutatie verbreekt de interactie van TEN2 −SS met LPHN3 en heft de exciterende synapsvorming op. b De TEN2 SS-isovorm heeft geen rotatieflexibiliteit rond de linker tussen de EGF-herhalingen en de rest van de extracellulaire kop zoals waargenomen in de kristalstructuur van de TEN2 SS-isovorm, wat aantoont dat de splitsing insert bemiddelt een dimere interactie tussen de twee TEN2 SS-protomeren 38 (Fig. 8a , VOB-ID: 6FB3). In plaats daarvan worden de TEN2 SS-protomeren dichtgeritst door de extra twee zoutbruggen (zwarte ballen) tussen de propellers van de TEN2 cis-dimeer. De LPHN-bindingsplaats op TEN2 SS bevindt zich dus niet op de juiste dockgeometrie om te interageren met het Lec-domein van LPHN3 dat tot expressie wordt gebracht op de naburige cel (hoewel het nog steeds een oplosbaar Lec-domein kan binden). De geometrie van TEN2 SS maakt waarschijnlijk andere hetero- of homofiele eiwitinteracties mogelijk die niet mogelijk waren in de −SS-isovorm, zoals TEN2-transhomodimerisatie, en bemiddelt remmende synapsvorming. De DHR-mutatie op TEN2 SS heeft geen effect op deze onbekende interacties en heeft dus geen invloed op het vermogen van TEN2 SS om remmende synapsen te induceren. Model gedeeltelijk op schaal getekend. De LPHN ECR-structuur (oranje) is gebaseerd op de Lec- en Olf-domeinstructuur (PDB: 5AFB), verbonden door een STP-rijke stengel aan de GAIN- en HormR-domeinstructuur (PDB: 4DLQ). TEN2-protomeren zijn gekleurd als cyaan en palegroen (VOB: 6CMX en 6FB3), FLRT-protomeren zijn gekleurd als magenta en grijs (VOB: 5CMN).

Zoals alternatieve splicing voorkomt de vorming van de TEN2 / LPHN3-interactie door de bindingsplaats te verbergen in plaats van deze te vernietigen, het is aannemelijk dat de SS-isovorm een ​​vorm aanneemt die andere TEN2-interacties mogelijk maakt die de −SS-isovorm niet kan bemiddelen. Inderdaad, de trans-dimerisatie van TEN2 werd alleen gerapporteerd door de SS isovorm 13 a > ; en eerdere studies suggereerden dat TEN2 SS-isovorm moet interageren met onbekende liganden om remmende synapsen te induceren 2 . Deze structuur van een teneurine-latrofilinecomplex in combinatie met onze biochemische resultaten tonen het duidelijke mechanistische verschil aan van exciterende vs. remmende synapsspecificatie en leiden tot voorheen onvoorstelbare nieuwe richtingen in zowel de synapsvorming als de alternatieve splicingvelden.

div >

Methoden

Celkweek

High-Five insectencellen (Trichoplusia ni, vrouwelijk, ovarium. Thermo Fisher, B85502 ) gekweekt in Insect-Xpress medium (Lonza, 04351Q) aangevuld met 10 μg / ml gentamicine bij 27 ° C werden gebruikt voor de productie van recombinante eiwitten. HEK293T-zoogdiercellen (ATCC, CRL-3216) werden gebruikt voor celoppervlakte-expressietests en flowcytometrie-bindingstesten en werden gekweekt in Dulbecco’s gemodificeerd Eagle’s medium (DMEM; Gibco, 11965092) aangevuld met 10% FBS (Sigma-Aldrich, F0926) bij 37 ° C in 5% CO 2.

Klonering en expressie in insectencellen

TEN2-splitsingsvariant Lasso (UniProt: Q9NT68 -2) en LPHN (LPHN1, UniProt: O88917 ; LPHN3, UniProt: Q9HAR2 ) constructen werden gekloneerd in een pAcGP67a-vector en uitgedrukt in High-Five insectencellen met behulp van het baculovirus-expressiesysteem. Sf9-cellen (Thermo Fisher, 12659017) werden gecotransfecteerd met het gelineariseerde baculovirus-DNA (Expression Systems, 91-002) en het geconstrueerde plasmide met behulp van het Cellfectin II (Thermo Fisher, 10362100) transfectiereagens. Baculovirus werd geamplificeerd in Sf9-cellen in SF900-III-medium dat 10% (v / v) FBS bevat (Sigma-Aldrich, F0926). Grootschalige eiwitexpressie werd uitgevoerd door infectie van High Five-cellen (Thermo Fisher, B85502 ) in Insect- XPRESS medium (Lonza, 12-730Q) medium met een celdichtheid van 2,0 x 10 6 cellen / ml gedurende 72 uur bij 27 ° C.

Voor de structurele studies, TEN2 ECRΔ1 (residuen T727-R2648) en LPNH3 ECR (residuen S21-V866) werden afzonderlijk gekloneerd met carboxyl-terminale 6XHis-tags en gezamenlijk tot expressie gebracht in High-Five insectencellen. De volgende primers werden gebruikt voor de amplificatie van High Five-cellen die humaan TEN2 ECRΔ1 tot expressie brachten: F: 5′-CATTCTGCCTTTGCGGCGGATCCCACTTCCTGTGCTGATAACAAGGATAATGAG-3 ′ en R: 5′-GGATCAGATCTGCAGCTTAGTGATGGGTGATGTGATGGTGATGG De volgende primers werden gebruikt voor de amplificatie van met High Five tot expressie gebrachte humane LPHN3 ECR: F: 5′-CATTCTGCCTTTGCGGCGGATCCCTCCCGCGCACCCATTCC-3 ′ en R: 5′-GGATCAGATCTGCAGCTTAGTGATGGTGATGGTGATGCACCGCGCGCGGCGCGCGCGCGCGCGC Tweeënzeventig uur na virale infectie werd het medium dat uitgescheiden geglycosyleerde eiwitten bevat verzameld en gedurende 15 minuten bij kamertemperatuur gecentrifugeerd bij 900 g. Het supernatant werd overgebracht naar een bekerglas en gemengd met (eindconcentraties): 50 mM Tris pH 8,0, 5 mM CaCl en 30 min geroerd. Na 30 minuten centrifugeren bij 8000 g werd het geklaarde supernatant 3 uur bij kamertemperatuur geïncubeerd met nikkel-nitrilotriazijn agarosehars (QIAGEN). De hars werd verzameld met een glazen Buchner-trechter en gespoeld met HBS-buffer die 20 mM imidazool bevatte, en vervolgens overgebracht naar een poly-prep-chromatografiekolom (Bio-rad). Het eiwit werd geëlueerd met HBS-buffer die 200 mM imidazol bevatte en werd uitgevoerd op chromatografie met uitsluiting op grootte (Superdex 200 10/300 GL; Superose 6 Increase 10/300 kolommen; GE Healthcare), gezuiverd in een uiteindelijke buffer bestaande uit 10 mM Tris pH 8,5 , 150 mM NaCl. Voor de flowcytometrie-bindingsassays werden LPHN1 Lec (residuen S26-Y131) en LPHN3 Lec (residuen S21-Y126) gekloneerd met carboxylterminal 6XHis-AVI-tags en gevangen op nikkel-nitrilotriazijnhars zoals hierboven beschreven. Na een wasbeurt met HBS-buffer die 20 mM imidazol bevatte, werden eindconcentraties van 50 mM Bicine pH 8,3, 100 mM NaCl, 10 mM Mg-acetaat, 10 mM ATP, 0,5 mM biotine en 5 mM BirA aan de hars toegevoegd, die vervolgens werd 2 uur gedraaid bij 27 ° C. Na het verwijderen van resterend BirA en ATP door wassen met HBS-buffer die 20 mM imidazol bevatte, werd het gebiotinyleerde lectine geëlueerd met HBS-buffer die 200 mM imidazol bevatte. Gezuiverd eiwit werd aangebracht op chromatografie met uitsluiting op grootte. De efficiëntie van biotinylering werd beoordeeld met behulp van een streptavidin bead pulldown assay.

Klonering en expressie in zoogdiercellen

TEN2 van volledige lengte (residuen M1-R2648) construct en TEN2-mutanten (DHR-mutant: D1737N, H1738T, R1739T; LR-mutant: L1990N, R1992T) met HA-tag (ingevoegd tussen K405 / E406) en carboxylterminal FLAG-tag werden gekloneerd in een pcDNA3.1-vector voor celoppervlakte-expressie assays en flowcytometriebindingsassays in HEK293T-cellen. De volgende primers werden gebruikt voor amplificatie van HEK-cellen die humaan TEN2 ECR tot expressie brachten: F: 5′-GGATGACGACGATAAAGGCGGTAAGCTTAGCCCACCTCTC-3 ′ en R: 5′-TTACTTATCGTCGTCATCCTTGTAATCCCTCTTTCCCATCTCATTCTGTCTT-3′. De volgende primers werden gebruikt voor amplificatie van HEK-cellen die humaan TEN2 ΔTox tot expressie brachten: F: 5′-GGATGACGACGATAAAGGCGGTAAGCTTAGCCCACCTCTC-3 ′ en R: 5′-TTACTTATCGTCGTCATCCTTGTAATCTTCATAGGGAGGAGGCACGAAATAC De volgende primers werden gebruikt voor amplificatie van HEK-cellen die humaan TEN2 ΔToxΔBarrel tot expressie brachten: F: 5′-GGATGACGACGATAAAGGCGGTAAGCTTAGCCCACCTCTC-3 ′ en R: 5′- TTACTTATCGTCGTCATCCTTGTAATCGAAGGCATTAAGAACGG TEN2 DHR-mutanten werden gegenereerd met behulp van een standaard tweestaps-PCR-gebaseerde strategie met primers: F: 5′-ATTCGGACTGAAAAGATCTATGATAACACCACGAAGTTCACCCTGAGGATCATTTATG-3 ′ en R: 5′-CATAAATGATCCTCAGGGTGAACTTCGTGTTATTATTATTATC TEN2 LR-mutanten werden gegenereerd met behulp van een standaard tweestaps-PCR-gebaseerde strategie met primers: F: 5′-AGTGAGACTCCCCTCCCCGTTGACAACTACACCTATGATGAGATTTCTGGCAAGGTG-3 ′ en R: 5′-CACCTTGCCAGAAATCTCATCATAGGGTGGAGAGGGTGAGACGGTAGGGAG Flowcytometrie

HEK293T-cellen werden gekweekt in platen met 6 putjes en werden getransfecteerd met 2 μg cDNA met behulp van LipoD293-transfectiereagens. Cellen met een confluentie van 50-60% werden tijdelijk als volgt getransfecteerd: 2 µg cDNA werd verdund in 50 µl serumvrij DMEM en 3 µl LipoD293 transfectiereagens (SignaGen, SL100668) werd verdund met 47 µl serumvrij DMEM. Het verdunde LipoD293 werd toegevoegd aan het verdunde cDNA en 10 minuten geïncubeerd. Vervolgens werd het transfectiemengsel druppelsgewijs aan elk putje toegevoegd. De cellen werden na 48 uur incubatie met citroenzoutoplossing (50 mM natriumcitraat, 135 mM KCl) losgemaakt en gewassen met PBS 2% BSA. Om TEN2 WT en mutante celoppervlakte-expressie te testen, werden cellen gekleurd met een primair antilichaammengsel: muis anti-FLAG M2 (Sigma, F3165) 1: 1000 en konijn anti-HA (Life Technologies, 7155 00) 1: 1000 gedurende 30 minuten bij kamertemperatuur. Na wassen met PBS 2% BSA werden cellen gekleurd met een secundair antilichaammengsel: ezel anti-muis Alexa Fluor 488 (nvitrogen, A21202 ) 1: 3000 en anti-konijn Alexa Fluor 647 van geit (Invitrogen, A32733 a >) 1: 3000 gedurende 30 minuten. Na het wassen werden celpellets onmiddellijk voor het verzamelen van de flowcytometriegegevens (Accuri C6 flowcytometer, 10000 gemeten gebeurtenissen) geresuspendeerd in PBS 2% BSA na het wassen. De verkregen gegevens werden geanalyseerd met behulp van de FlowJo-analysesoftware (FlowJo LLC).

Voor de bindingsassays werd His-Avi-gelabelde Lec gevangen op nikkel-nitrilotriazijnhars en gezuiverd zoals hierboven beschreven. Gebiotinyleerd Lec werd getetrameriseerd en fluorescent gelabeld door incubatie met NeutrAvidin DyLight 488 (Thermo, 22832) gedurende 20 minuten op ijs. Gekweekte cellen die HA-gelabeld TEN2 tot expressie brengen, werden losgemaakt en vervolgens gewassen zoals hierboven beschreven. Vervolgens werden de cellen gekleurd met konijn anti-HA 1: 1000 antilichaam en, na twee wascycli, gekleurd met geiten anti-konijn Alexa Fluor 647 antilichaam in aanwezigheid van het 100 nM NAV488 gelabelde Lec-mengsel. De volgende primers werden gebruikt voor amplificatie van His-Avi-gelabeld humaan LPHN1 Lec: F: 5′-CGGCGGCGCATTCTGCCTTTGCGGCGAGCCGGGCTGGACTCCCATTTGG-3 ′ en R: 5′-CTTCTGAGCCTCGAAAATATCATTAAGACCGCGACGAG De volgende primers werden gebruikt voor amplificatie van His-Avi-gelabeld humaan LPHN3 Lec: F: 5′- GGCGGCGCATTCTGCCTTTGCGGCGTCCCGCGCACCCATTCCTATGGCCG-3 ‘en R: 5′- TTCTGAGCCTCGAAAATATCATTAAGACCGCGATATGGCACGCACTCGTACTGCACT-3’. P>

Cell -aggregatietesten

HEK293T-cellen (ATCC) werden in een T-75-kolf tot 90% confluentie gekweekt. Cellen werden getrypsiniseerd met 3 ml 0,05% trypsine-EDTA (Gibco, 25300-054) en geresuspendeerd tot 10 ml met DMEM / 10% FBS / 1% penicilline-streptomycine (compleet DMEM). Driehonderd µL celsuspensie werd toegevoegd aan elk putje van een plaat met 6 putjes die 3 ml Compleet DMEM-medium bevatte en overnacht bij 37 ° C geïncubeerd. Cellen in elk putje werden vervolgens gecotransfecteerd met 2 µg van ofwel pCMV (lege vector) pEmerald, pCMV LPHN3 pEmerald, pCMV (lege vector) pCMV dsRed of dsRed en het aangegeven TEN2-construct met behulp van de calciumfosfaatmethode. Alle cDNA’s werden gecodeerd in de pCMV5- of pcDNA3-vector en gestuurd door de CMV-promotor. Drie dagen na transfectie werd het medium afgezogen en werden de cellen voorzichtig gewassen met 2 ml PBS. Cellen werden geresuspendeerd door 1 ml resuspensieoplossing (PBS met 1 mM EGTA) toe te voegen en vervolgens 5 minuten bij 37 ° C geïncubeerd. Vijftien µL van 1 mg / 20 µL DNAse (Sigma, D5025) werd vervolgens aan elk putje toegevoegd en cellen werden getritureerd door op en neer (16 keer) in elk putje te pipetteren om cellen van de plaatbodem te resuspenderen en eencellige schorsingen. Cellen werden vervolgens overgebracht naar een nieuwe Eppendorf-buis en aan elk monster werd nog eens 15 µL DNAse-oplossing toegevoegd. Cellen werden gemengd in een verhouding van 1: 1 door 70 µL pCMV (lege vector) pEmerald of LPHN3 pEmerald toe te voegen met 70 µL pCMV (lege vector) pCMV-dsRed of TEN2 Construct dsRed in een nieuwe Eppendorf die 360 ​​µL bevatte Incubation Solution (DMEM met 50 mM HEPES-NaOH pH 7,4, 10% FBS, 10 mM CaCl 2 en 10 mM MgCl 2 ) voor een uiteindelijk volume van 500 µL. Het mengsel werd fijngewreven en het volledige volume werd overgebracht naar één putje in een niet-beklede plaat met 12 putjes (Costar, 3737). Afbeeldingen werden onmiddellijk genomen (tijd = 0) met behulp van een Leica Fluorescente DMIL LED-microscoop met een 10x objectief. Cellen werden vervolgens op een schudincubator bij 125 rpm bij 37 ° C gedurende 20 minuten geplaatst en opnieuw in beeld gebracht (tijd = 20). De aggregatie-index op tijd = 20 werd berekend met ImageJ, waarbij het percentage signaal / frame werd gemeten dat werd ingenomen door cellen die complexen vormen van twee of meer cellen ten opzichte van het totale signaal van het frame.

Cel -oppervlakbindingsassays

HEK293T-cellen (ATCC) werden in een T-75-kolf tot 90% confluentie gekweekt. Cellen werden getrypsiniseerd met 3 ml 0,05% trypsine-EDTA (Gibco, 25300-054) en geresuspendeerd tot 10 ml DMEM 10% FBS 1% penicilline-streptomycine (compleet DMEM) -medium. Vijftig µL celsuspensie werd toegevoegd aan elk putje van een plaat met 24 putjes die een met Matrigel gecoate dekglaasje en 1 ml compleet DMEM bevatte en overnacht geïncubeerd. Cellen werden vervolgens gecotransfecteerd met 1 µg van ofwel leeg pCMV, wildtype Teneurin 2 of het aangegeven mutante Teneurin-construct en 1 µg pEmerald met behulp van de calciumfosfaatmethode en 2 dagen bij 37 ° C geïncubeerd. Transfectiemedia werden voorzichtig verwijderd en aan elk putje werd 500 µL gekoeld DMEM met 250 µM gezuiverd, Avi-fusion, gebiotinyleerd, rat LPHN1 Lec of humaan LPHN3 Lec toegevoegd. Platen werden in folie gewikkeld en overnacht bij 4 ° C geïncubeerd om endocytose te verminderen, onder voorzichtig schudden. Dit werd in wezen uitgevoerd zoals beschreven in 55 . Cellen werden voorzichtig 2x gewassen met 1 ml PBS en gefixeerd met 300 µl ijskoude 4% PFA / 4% sucrose / PBS. Platen werden in folie gewikkeld en gedurende de fixatie gedurende 20 minuten bij 4 ° C geïncubeerd. Cellen werden voorzichtig 3x gewassen met 1 ml PBS bij kamertemperatuur en 1 uur bij kamertemperatuur geblokkeerd met 300 µl 5% BSA (Sigma, 10735086001) / PBS (blokkerende buffer). Gebonden gebiotinyleerd Lec werd gedetecteerd door immunofluorescentie met 300 µL per putje Streptavidin (AlexaFluor-555 geconjugeerd, Invitrogen, S21381 a >, bij verdunning 1: 10.000) verdund in blokkerende buffer gedurende 1 uur bij kamertemperatuur. Cellen werden voorzichtig 3x gewassen met 1 ml PBS. Cellen werden opnieuw geblokkeerd en HA-gemerkte oppervlakte-teneurinen werden gedetecteerd door 300 µL konijn-anti-HA-antilichaam (Cell Signaling Technologies, 3724) toe te voegen in een verdunning van 1: 1.000 in blokkerende buffer. Cellen werden voorzichtig 3x gewassen met 1 ml PBS. Secundaire antilichamen van konijnen tegen konijnen (Alexa-Fluor 633 geconjugeerd, Invitrogen) en DAPI (Sigma, 10236276001) kleuring werd gedurende 30 minuten uitgevoerd bij respectievelijk 1: 10.000 en 1: 5.000 in blokkerende buffer, gevolgd door 3x zachte wasbeurten met 1 ml PBS. Dekglaasjes werden gemonteerd op dia’s (UltraClear-microscoopglaasjes Denville Scientific, M1021) in montagemedia (Fluoromount-G, Southern Biotech, 010020). Afbeeldingen werden verkregen met een Nikon A1 Eclipse Ti2 confocale microscoop met een × 60 olie-immersie objectief, beheerd door NIS-Elements AR acquisitie software. Dezelfde confocale acquisitie-instellingen werden toegepast op alle monsters van het experiment. Verzamelde z-stacks met een z-stapgrootte van 0,4 µm werden blind geanalyseerd met Nikon Elements Analysis-software. Co-lokalisatie werd berekend met behulp van de Pearson-correlatiecoëfficiënt van Lec-Streptavidin-555 tot Teneurin-HA-633-emissie.

Test voor kunstmatige synapsvorming

HEK293T-cellen werden getransfecteerd met de expressievectoren van de celadhesiemoleculen. 24 uur later werden HEK293T-cellen samen gekweekt met gekweekte corticale neuronen (DIV16) van PO-muizen. Na 24 uur werden cellen gefixeerd met 4% PFA en immunogekleurd met anti-Flag van konijn (Sigma; 1: 1000 beide) samen met anti-PSD95 van muis (Sysy, 124011, 1: 500) of anti-GABAA a2 van muis (Sysy; 224211, 1: 500). Afbeeldingen werden verzameld met een Nikon A1 confocale microscoop met een × 60 objectief. Een humane NPR-mutant (1-118 aa van het eiwit van volledige lengte) die een A-domein bevat dat sequenties met een lage complexiteit bevat, wordt gebruikt als de negatieve controle bij de kunstmatige synapsvormingstesten. De signalen van de synaptische markers die naar het oppervlak van de HEK293T-cellen werden gerekruteerd, werden gekwantificeerd met behulp van Image J. Genormaliseerde waarden zijn gelijk aan de fluorescerende intensiteit van de synaptische marker die werd onderzocht (GABAα2 / PSD95) / de fluorescerende intensiteit van het Flag-tagged eiwit uitgedrukt in de HEK-cellen (TENs /Nrn1β).

Cryo-EM data-acquisitie

2,5 μl gezuiverd humaan TEN2 ECRΔ1 en humaan LPHN3 ECR-complex (0,22 mg / ml) werd aangebracht op glimontladen holey koolstofroosters (Quantifoil R1.2 / 1.3, 300 mesh) en verglaasd met behulp van een Vitrobot Mark IV (FEI Company). Het monster werd gevisualiseerd met behulp van een Titan Krios-elektronenmicroscoop (FEI) die werkt bij 300 kV en uitgerust met een K3 directe elektronen-detector (Gatan, Inc.). Afbeeldingen werden opgenomen met een nominale vergroting van × 81.000 in de telmodus met superresolutie, wat overeenkomt met een pixelgrootte van 0,54 Å op het monsterniveau. Om de gegevensverzamelingssnelheid te maximaliseren en de beeldafwijkingen minimaal te houden, werd beeldverschuiving gebruikt als beeldvormingsstrategie met één gegevenspositie per gat met vier gaten in één sjabloon met één focuspositie. In totaal werden 4967 beelden met onscherptewaarden in het bereik van −1,0 tot −2,5 μm opgenomen met een dosissnelheid van 14,6 elektronen / Å 2 / s. De totale belichtingstijd werd ingesteld op 4,2 s met frames die elke 0,105 s werden opgenomen, wat resulteerde in een geaccumuleerde dosis van ongeveer 60,1 elektronen per Å 2 en een totaal van 40 frames per filmstapel.

Beeldverwerking en 3D-reconstructies

Stapelbeelden werden onderworpen aan door beweging veroorzaakte bewegingscorrectie met MotionCor2 56 . CTF-parameters voor elke opname werden bepaald door CTFFIND4 57 . Partikelselectie, twee- en driedimensionale classificaties werden aanvankelijk uitgevoerd op een binned dataset met een pixelgrootte van 4,32 Å met behulp van RELION-3 58 . In totaal werden 4.475.958 deeltjesprojecties geselecteerd met behulp van geautomatiseerde deeltjespluk en onderworpen aan referentievrije tweedimensionale classificatie om vals-positieve deeltjes of deeltjes die in slecht gedefinieerde klassen zijn ingedeeld te verwijderen, resulterend in 3.307.148 deeltjesprojecties voor verdere verwerking. De initiële 3D-classificatie op basis van maximale waarschijnlijkheid werd uitgevoerd op een binned dataset met een pixelgrootte van 4,32 Å met behulp van de eerder gerapporteerde TEN2-structuur 2 als referentiemodel. De gedetailleerde gegevensverwerkingsstroom wordt getoond in aanvullende figuren. 2 en 3 . Kort samengevat werden voor Tenurin-Letrophilin-complex 1.309.684 deeltjes geselecteerd die een goed gedefinieerde dichtheid van het Lec-domein vertoonden na initiële 3D-classificatierondes. Vervolgens werden twee rondes van gerichte 3D-classificatie met masker rond Lec-domein uitgevoerd zonder uitlijning. 3D-verfijning en nabewerking werd uitgevoerd op de beste klasse met duidelijke functies voor het Lec-domein (aanvullende afbeelding 2 ). De uiteindelijke kaart voor TEN2_Lec werd opgelost op 2,97 Å (aanvullende afbeelding 2 ). Om domein 3 op te lossen, werd dezelfde dataset opnieuw verwerkt met een totaal van 1.137.765 deeltjes die goed opgelost domein 3 vertoonden. Er werden twee rondes van gerichte 3D-classificatie met masker rond domein 3 uitgevoerd, gevolgd door 3D-verfijning en nabewerking. De definitieve kaart voor TEN2_domein 3 werd opgelost op 3,07 Å (aanvullende afbeelding 3 ).

De gerapporteerde resoluties zijn gebaseerd op de gouden standaard Fourier-schaalcorrelatie (FSC) met het 0.143 criterium (aanvullende afbeelding 1c ). Alle dichtheidskaarten zijn gecorrigeerd voor de modulatieoverdrachtsfunctie (MTF) van de K3 directe detector en vervolgens verscherpt door een temperatuurfactor toe te passen die werd geschat met behulp van nabewerking in RELION-3. Lokale resolutie werd bepaald met ResMap 59 met halfreconstructies als inputkaarten (aanvullend Fig. 1d ).

Modelbouw en verfijning

Modelbouw was gebaseerd op de structuur van de menselijke TEN2 ECR (VOB) : 6CMX ) en het Lec-domein van humaan LPHN3 (VOB: 5AFB en 5FTT). De modellen werden eerst in de EM-dichtheidskaarten gedockt met behulp van Chimera 60 en vervolgens handmatig gecontroleerd en aangepast residu per residu om de dichtheid te passen met COOT 61 . De ECR van TEN2 is gebaseerd op die van kip TEN2 (VOB: 6FB3 ) en handmatig aangepast aan de menselijke volgorde en splitsingsvorm . Merk op dat het Lec-domein niet zo goed was opgelost als TEN2, dus het was aangemeerd als een star lichaam zonder de zijketens te passen en te manipuleren. Beide kaarten (TEN2 / LPHN3 en TEN2 gericht op domein 3) werden gebruikt voor modelbouw. Er is een lichte verschuiving tussen de twee kaarten van reconstructie, dus ze werden uitgelijnd op basis van TEN-Lec vóór modelbouw. Het uiteindelijke model met zowel ECR van TEN2 als Lec-domein van LPHN3 werd wereldwijd verfijnd en geminimaliseerd in de echte ruimte met behulp van de phenix_real_space_refine-module in Phenix 62 eerst tegen de TEN2-domein 3-kaart, terwijl het Lec-domein als een star lichaam behouden blijft, en vervolgens tegen de TEN2-Lec-kaart, terwijl het domein 3 als een star lichaam blijft. FSC-curven werden berekend tussen het resulterende model en beide kaarten met behulp van Phenix M-triage (aanvullende afbeelding 1 ). De definitieve modelstatistieken worden gegeven in tabel 1 .

Negen N-gekoppelde glycosyleringsplaatsen (op residuen N1490, N1586, N1647, N1681, N1766, N1867, N2071, N2211, N2522.) En vijf disulfidebindingen (C1394-C1402), (C1396-C1404), (C1106-C1109), (C1210-C1218), (C1277-C1330) werden waargenomen in TEN2.

Kwantificering en statistische analyse

Foutbalken in Fig. 5 , 6 , 7 , 8 en aanvullende afbeelding. 6 staat voor ± SEM. Elke meting werd ten minste driemaal onafhankelijk herhaald. Gegevens werden geanalyseerd met software GraphPad Prism en ImageJ.

Rapportagesamenvatting

Meer informatie over onderzoeksontwerp is beschikbaar in de Nature Research Reporting Summary gelinkt aan dit artikel.

                                                 

Data-beschikbaarheid

De cryo-EM-dichtheidskaart heeft gedeponeerd in de Electron Microscopy Data Bank (https://www.ebi.ac.uk/pdbe/emdb/) onder toegangscode EMD-21205 en de modelcoördinaten zijn gedeponeerd in de Protein Data Bank ( http://www.rcsb.org ) onder toegangsnummer VOB 6VHH . Gegevens die de bevindingen van dit manuscript ondersteunen, zijn op redelijk verzoek verkrijgbaar bij de desbetreffende auteurs. Een rapportagesamenvatting voor dit artikel is beschikbaar als een bestand met aanvullende informatie. De brongegevens die aan Fig. 2 e, 5 b – d, 6 c, d, 7 c, e, 8b en aanvullende figuren. 6b , c en 7 worden geleverd als een brongegevensbestand.

Referenties

  • 1.

    Garber, K. Neuroscience. De oorzaak van autisme kan liggen in abnormale banden bij de synaps. Wetenschap 317 , 190–191 (2007).

  • 2.

    Li, J. et al. Structurele basis voor teneurinefunctie in circuitbedrading: een toxinemotief bij de synaps. Cell 173 , 735–748 (2018).

  • 3.

    Sando, R., Jiang, X. & Sudhof, TC Latrofiline GPCR’s sturen synapsspecificiteit door samenvallende binding van FLRT’s en teneurines. Wetenschap 363 , eaav7969 (2019).

  • 4.

    Baumgartner, S. & Chiquet-Ehrismann, R. Tena, een Drosophila -gen gerelateerd aan tenascine, vertoont selectieve transcriptlokalisatie. Mech. Dev. 40 , 165–176 (1993).

  • meta > 5 .

    Baumgartner, S., Martin, D. & Hagios, C. Chiquet-Ehrismann R. Tenm, een Drosophila gen gerelateerd aan tenascin, is een nieuw paarregelgen. EMBO J. 13 , 3728–3740 (1994).

  • 6.

    Levine, A. et al. Odd Oz: een nieuw Drosophila paarregelgen. Cell 77 , 587–598 (1994).

  • 7.

    Oohashi, T. et al. Muis tien-m / Odz is een nieuwe familie van dimere type II-transmembraaneiwitten die in veel weefsels tot expressie worden gebracht. J. Cell Biol. 145 , 563-577 (1999).

  • 8.

    Feng, K. et al. Alle vier de leden van de Ten-m / Odz-familie van transmembraanproteïnen vormen dimeren. J. Biol. Chem. 277 , 26128–26135 (2002).

  • 9.

    Vysokov, NV et al. Het mechanisme van gereguleerde afgifte van Lasso / Teneurin-2. Front. Mol. Neurosci. 9 , 59 (2016 ).

  • 10.

    Doyle, SE et al. Latrophilin-2 is een nov el component van de epitheliale-mesenchymale transitie binnen het atrioventriculaire kanaal van het embryonale kippenhart. Dev. Dyn. 235 , 3213–3221 (2006).

  • meta > 11. span>

    Hong, W., Mosca, TJ & Luo, L. Teneurins instrueren synaptische partner-matching in een reukkaart. Nature 484 , 201–207 (2012).

  • 12.

    Mosca, TJ, Hong, W., Dani, VS, Favaloro, V. & Luo, L. Trans-synaptic signalering van teneurine in de organisatie van neuromusculaire synaps en doelkeuze. Nature 484 , 237–241 (2012).

  • 13.

    Berns, DS, DeNardo, LA, Pederick, DT & Luo, L. Teneurin-3 bestuurt de topografische circuitassemblage in de hippocampus. Nature 554 , 328–333 (2018).

  • 14.

    Mosca, TJ & Luo, L. Synaptische organisatie van de Drosophila antennaalkwab en de regulering ervan door de Teneurins. eLife 3 , e03726 (2014).

  • 15.

    Silva, JP et al. Latrophilin 1 en zijn endogene ligand Lasso / Teneurin-2 vormen een transsynaptisch receptorpaar met hoge affiniteit met signaleringsmogelijkheden. Proc. Natl Acad. Sci. ONS A 108 , 12113–12118 (2011).

  • 16.

    Boucard, AA, Maxeiner, S. & Sudhof, TC Latrophilins functioneren als heterofiele celadhesiemoleculen door te binden aan teneurines: regulering door alternatieve splicing. J. Biol. Chem. 289 , 387–402 (2014).

  • 17 .

    Woelfle, R., D’Aquila, AL & Lovejoy, DA Teneurins, TCAP en latrophilins: rollen in de etiologie van stemmingsstoornissen. Transl. Neurosci. 7 , 17–23 (2016).

  • 18.

    Aldahmesh, MA, Mohammed, JY, Al-Hazzaa, S. & Alkuraya, FS Homozygote nulmutatie in ODZ3 veroorzaakt microfthalmie bij mensen. Genet. Med. 14 , 900–904 (2012).

  • 19.

    Alkelai, A. et al. Een rol voor TENM1-mutaties bij aangeboren algemene anosmie. Clin. Genet. 90 , 211–219 (2016).

  • 20.

    Hor, H. et al. Missense-mutaties in TENM4, een regulator van axongeleiding en centrale myelinisatie, veroorzaken essentiële tremor. Hum. Mol. Genet. 24 , 5677–5686 (2015).

  • 21.

    Ziegler, A., Corvalan, A., Roa, I., Branes, JA & Wollscheid, B. Teneurin-eiwit familie: een opkomende rol in menselijke tumorigenese en resistentie tegen geneesmiddelen. Cancer Lett. 326 , 1-7 (2012).

  • 22.

    Chassaing, N. et al. Bevestiging van TENM3-betrokkenheid bij autosomaal recessieve colobomateuze microfthalmie. Am. J. Med. Genet. A 170 , 1895–1898 (2016).

  • 23.

    Talamillo, A. et al. ODZ1 zorgt ervoor dat glioblastoom de invasiviteit kan behouden door een Myc-afhankelijke transcriptionele opregulatie van RhoA. Oncogene 36 , 1733–1744 (2017).

  • 24.

    Graumann, R. et al. Expressie van teneurines wordt geassocieerd met tumordifferentiatie en overleving van de patiënt bij eierstokkanker. PloS ONE 12 , e0177244 (2017).

  • 25.

    Krasnoperov, VG et al. De calciumonafhankelijke receptor van alfa-latrotoxine is geen neurexine. Biochem. Biophys. Res. Commun. 227 , 868–875 (1996).

  • 26.

    Lelianova, VG et al. Alpha-latrotoxinereceptor, latrophilin, is een nieuw lid van de secretinefamilie van G-proteïne gekoppelde receptoren. J. Biol. Chem. 272 , 21504–21508 (1997).

  • meta > 27.

    Sugita, S., Ichtchenko, K., Khvotchev, M. & Sudhof, TC alpha-Latrotoxin receptor CIRL / latrophilin 1 (CL1) definieert een ongebruikelijke familie van alomtegenwoordige aan G-proteïne gekoppelde receptoren. G-eiwitkoppeling niet vereist voor het veroorzaken van exocytose. J. Biol. Chem. 273 , 32715–32724 (1998).

  • 28.

    Krasnoperov , VG et al. alpha-Latrotoxin stimuleert exocytose door de interactie met een neuronale G-proteïne gekoppelde receptor. Neuron 18 , 925–937 (1997).

  • 29.

    Sugita, S., Khvochtev, M. & Sudhof, TC Neurexins zijn functionele alfa-latrotoxinereceptoren. Neuron 22 , 489–496 (1999).

  • 30.

    Sudhof, TC alpha-Latrotoxin en zijn receptoren: neurexins en CIRL / latrophilins. Annu. Rev. Neurosci. 24 , 933–962 (2001).

  • 31.

    Deak, F. et al. Alfa-latrotoxine stimuleert een nieuwe route van Ca2 -afhankelijke synaptische exocytose, onafhankelijk van de klassieke synaptische fusiemachines. J. Neurosci. 29 , 8639–8648 (2009).

  • 32.

    Anderson, GR et al. Postsynaptische adhesie GPCR latrofiline-2 medieert doelherkenning in de assemblage van de entorhinal-hippocampus synaps. J. Cell Biol. 216 , 3831–3846 (2017).

  • 33.

    Hamann, J. et al. Internationale vereniging van basis- en klinische farmacologie. XCIV. Adhesie G-eiwit gekoppelde receptoren. Pharmacol. Rev. 67 , 338–367 (2015).

  • 34.

    Kan, Z. et al. Diverse somatische mutatiepatronen en pathway-veranderingen bij menselijke kankers. Nature 466 , 869–873 (2010).

  • 35.

    O’Hayre, M. et al. Het opkomende mutatielandschap van G-eiwitten en G-eiwit-gekoppelde receptoren bij kanker. Nat. Rev. Cancer 13 , 412–424 (2013).

  • 36.

    Arcos-Burgos, M. et al. Een veel voorkomende variant van het latrofiline 3-gen, LPHN3, verleent gevoeligheid voor ADHD en voorspelt de effectiviteit van stimulerende medicatie. Mol. Psychiatrie 15 , 1053-1066 (2010).

  • 37.

    O’ Sullivan, ML et al. FLRT-eiwitten zijn endogene latrofilineliganden en reguleren de exciterende synapsontwikkeling. Neuron 73 , 903–910 (2012).

  • 38.

    Jackson, VA et al. Structuren van teneurine adhesie receptoren onthullen een oude plooi voor cel-celinteractie. Nat. Commun. 9 , 1079 (2018).

  • 39.

    Lu, YC et al. Structurele basis van latrofiline-FLRT-UNC5-interactie bij celadhesie. Structuur 23 , 1678–1691 (2015).

  • 40.

    Meusch, D. et al. Mechanisme van Tc-toxinewerking onthuld in moleculair detail. Nature 508 , 61–65 (2014).

  • 41.

    Vakonakis, I., Langenhan, T., Promel, S., Russ, A. & Campbell, ID-oplossing structuur en suikerbindend mechanisme van latrofiline-1 RBL van muis: een aan de 7TM-receptor gebonden lectine-achtig domein. Structuur 16 , 944–953 (2008).

  • 42.

    Arac, D. et al. Structuren van neuroligin-1 en het neuroligin-1 / neurexin-1-bètacomplex onthullen specifieke eiwit-eiwit- en eiwit-Ca2 -interacties. Neuron 56 , 992–1003 (2007).

  • 43.

    Wilson, SC et al. Structuren van neurexophiline-neurexinecomplexen onthullen een regulerend mechanisme van alternatieve splicing. EMBO J. 38 , e101603 (2019).

  • 44.

    Del Toro, D. et al. Structurele basis van teneurine-latrofiline-interactie in repulsieve begeleiding van migrerende neuronen. Cell 180 , 323–339 (2020).

  • meta> 45.

    Braunschweig, U., Gueroussov, S., Plocik, AM, Graveley, BR & Blencowe, BJ Dynamische integratie van splicing binnen genregulerende routes . Cell 152 , 1252–1269 (2013).

  • 46.

    Chen, M. & Manley, JL Mechanismen van alternatieve spliceregulatie: inzichten uit moleculaire en genomische benaderingen. Nat. Rev. Mol. Cell Biol. 10 , 741–754 (2009).

  • 47.

    Kalsotra, A. & Cooper, TA Functionele gevolgen van ontwikkelingsgereguleerde alternatieve splicing. Nat. Rev. Genet. 12 , 715–729 (2011).

  • 48.

    Leon, K. et al. Structurele basis voor adhesie G-proteïne gekoppelde receptor Gpr126-functie. Nat. Commun. 11 , 194 (2020).

  • 49.

    Aoto, J., Martinelli, DC, Malenka, RC, Tabuchi, K. & Südhof, TC Presynaptic neurexin-3 alternatieve splitsing controleert transsynaptisch postsynaptische handel in AMPA-receptoren. Cell 154 , 75–88 (2013).

  • 50.

    Irimia, M. et al. Een sterk geconserveerd programma van neuronale micro-exonen is verkeerd gereguleerd in autistische hersenen. Cell 159 , 1511–1523 (2014).

  • 51.

    Thalhammer, A. et al. Alternatieve splitsing van P / Q-type Ca (2 ) kanalen vormt de presynaptische plasticiteit. Cell Rep. 20 , 333–343 (2017).

  • 52.

    Fuccillo, MV et al. Eencellige mRNA-profilering onthult celtypespecifieke expressie van neurexine-isovormen. Neuron 87 , 326–340 (2015).

  • 53.

    Shen, KC et al, Regulatie van neurexine 1beta tertiaire structuur en ligandbinding door alternatieve splicing. Structuur 16 , 422-431 (2008).

  • 54.

    O’Sullivan, ML, Martini, F., von Daake, S., Comoletti , D. & Ghosh, A. LPHN3, een presynaptische adhesie-GPCR die betrokken is bij ADHD, reguleert de sterkte van neocorticale 2/3 synaptische input naar laag 5. Neural Dev. 9 b>, 7 (2014).

  • 55.

    Boucard , AA, Ko, J. & Sudhof, TC Neurexinebinding met hoge affiniteit voor celadhesie Aan G-proteïne gekoppelde receptor CIRL1 / latrofiline-1 produceert een intercellulair adhesiecomplex. J. Biol. Chem. 287 , 9399–9413 (2012).

  • meta > 56.

    Glodeck, D., Hesser, J. & Zheng, L. Vervormingscorrectie van EPI-gegevens met behulp van multimodale niet-rigide registratie met een anisotrope regularisatie. Magn. Reson. Beeldvorming 34 , 127–136 (2016).

  • 57.

    Mindell, JA & Grigorieff, N. Nauwkeurige bepaling van lokale defocus en specimenkanteling in elektronenmicroscopie. J. Struct. Biol. 142 , 334–347 (2003).

  • 58.

    Zivanov, J. et al. Nieuwe tools voor geautomatiseerde cryo-EM-structuurbepaling met hoge resolutie in RELION-3. eLife 7 , e42166 (2018).

  • meta > 59.

    Kucukelbir, A., Sigworth, FJ & Tagare, HD Kwantificering van de lokale resolutie van de cryo-EM-dichtheid kaarten. Nat. Methoden 11 , 63–65 (2014).

  • 60.

    Pettersen EF et al. UCSF Chimera – een visualisatiesysteem voor verkennend onderzoek en analyse. J. Comput Chem. 25 , 1605–1612 (2004).

  • meta> 61.

    Emsley, P., Lohkamp, ​​B., Scott, WG & Cowtan, K. Eigenschappen en ontwikkeling van Coot. Acta Crystallogr. D: Biol. Crystallogr. 66 , 486–501 (2010).

  • 62.

    Adams PD et al. PHENIX: een uitgebreid op Python gebaseerd systeem voor macromoleculaire structuuroplossing. Acta Crystallogr. D: Biol. Crystallogr. 66 , 213–221 (2010).

  • 63.

    Landau M. et al. ConSurf 2005: de projectie van evolutionaire conserveringsscores van residuen op eiwitstructuren. Nucleic Acids Res. 33 , W299 – W302 (2005).

  • Download referenties

    Dankwoord

    De auteurs bedanken Tobin R. Sosnick voor het genereus verstrekken van DesG-tagconstructie om het gedrag van het eiwit te verbeteren, Anthony Kossiakoff, Engin Ozkan voor het gebruik van de flowcytometer, Georgios Skiniotis en Moran Shalev-Binami voor de eerste gegevensverzameling. Dit onderzoek werd gedeeltelijk ondersteund door de National Cryo-EM-faciliteit van het National Cancer Institute in het Frederick National Laboratory for Cancer Research onder contract HSSN261200800001E. Dit werk werd ondersteund door subsidies R01 GM120322 (tegen DA) en R01 GM134035-01 (tegen DA), Chicago Biomedical Consortium Catalyst Award C-086 (tegen MZ) en de American Heart Association-subsidie ​​# 19POST34380439 / Jingxian Li / 2019-2020 (tegen JX).

    Auteurinformatie

    Auteur-opmerkingen

    1. Deze auteurs hebben evenveel bijgedragen: Jingxian Li, Yuan Xie.

    Affiliations

    1. Afdeling of Biochemistry and Molecular Biology, The University of Chicago, Chicago, IL, 60637, USA
      • Jingxian Li
      • , Yuan Xie
      • , Szymon P . Kordon
      • , Man Pan
      • , Katherine Leon
      • , Minglei Zhao
      • & Demet Araç
    2. Grossman Institute for Neuroscience, Quantitative Biology and Human Be havior, The University of Chicago, Chicago, IL, 60637, USA
      • Jingxian Li
      • , Szymon P. Kordon
      • , Katherine Leon li>
      • & Demet Araç
    3. Afdeling Molecul ar en cellulaire fysiologie, Stanford University, Stanford, CA, 94305, VS
      • Shaleeka Cornelius
      • , Xian Jiang
      • , Richard Sando li >
      • & Thomas C. Südhof
    4. Howard Hughes Medical Institute, Chevy Chase, MD, VS
      • Shaleeka Cornelius
      • , Xian Jiang
      • , Richard Sando
      • & Thomas C. Südhof
    5. Auteurs

      1. Jingxian Li
        Je kunt ook naar deze auteur zoeken in
      2. Yuan Xie
        Je kunt ook naar deze auteur zoeken in
      3. Shaleeka Cornelius
        Je kunt ook naar deze auteur zoeken in
    6. Xian Jiang span >
      Je kunt ook naar deze auteur zoeken in

    7. Richard Sando
      Dat kan zoek ook naar deze auteur in

    8. Szymon P. Kordon
      Je kunt ook naar deze auteur zoeken in
    9. Man Pan
      Je kunt ook naar deze auteur zoeken in
    10. Katherine Leon
      Je kunt ook naar deze auteur zoeken in
    11. Thomas C. Südhof span >
      Je kunt ook naar deze auteur zoeken in

    12. Minglei Zhao
      Je kunt ook naar deze auteur zoeken in

    13. Demet Araç
      Je kunt ook naar deze auteur zoeken in

    Bijdragen

    JL en D.A. ontwierp alle experimenten en interpreteerde resultaten. J.L. gekloond, tot expressie gebracht en gezuiverd TEN2 / LPHN3-complex, voerde TEN2-gerelateerde biochemische karakterisaties en monsteronderzoek uit, ontwierp en voerde de HEK-celexpressie en flowcytometrie-bindingsassays uit. Y.X. en M.Z. Cryo-EM gegevensverzameling en kaartberekening, modelbouw en verfijning uitgevoerd. Y.X. en M.Z. structurele analyse uitgevoerd met hulp van J.L. en D.A. T.C.S., R.S., X.J. en S.C hebben de celaggregatietests, celoppervlakkleuringstests en synapsevormingstests ontworpen en uitgevoerd. S.P.K. nam deel aan TEN2 alternatieve biochemische karakteristieken die verband houden met de splitsingsplaats. M.P. en K.L. geholpen bij het screenen van monsters door EM. D.A. schreef de krant met hulp van M.Z. T.C.S. J.L. en Y.X. D.A. en M.Z. hield toezicht op het project.

    Corresponderende auteurs

    Correspondentie met                  Minglei Zhao een> of Demet Araç .

    Ethische verklaringen

                                   

    Concurrerende belangen

                    

    De auteurs verklaren geen concurrerende belangen.

                               

    Aanvullende informatie h2>

    Opmerking van de uitgever Springer Nature blijft neutraal met betrekking tot claims over jurisdicties in gepubliceerde kaarten en institutionele affiliaties.

    Aanvullende informatie